Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000480.1

Orthogroup ID

OG0003474

Physical Location & Seq

Genomic Coordinates Forward (+)

24191 .. 29112

Gene Structure 4922 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000480.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1551 bp

atgagcttggaagggacacttcgcagaaccttcgtggtgttaagtttacttcgttgtcttcaactcaactgtttgcttgttgccggcattcaacgccatctctccactattgagtctccatcatcttcttcattctatcaatatttgatcggagcaaccaaagtagcccatttgattatctccactttcagagtggccaagactttgaagaaagttgatcaaatccaatccatttttgcttctgggtctgagatgggagccataggtgtaaaggtagaccttgaatcagatgaggagatcccatttagctcatcagcagctacgaataaagtagaggccttggattttgagatggttcatttgccttcgcggccagttatgccaaactcatggattgcaagacatatagggatgagagccgtgaggagtatttatgttgtcttattaaaagcaaagatcaacatgttgctaccatttggtccactggcaatcctgctacattacgttactggaaagcatggatgggtctttttcttcagcttattgggcatcatacctttggcagagcgtctaggatatgcgactgagcaactcgctttctacacagggccaacagttgggggacttttaaatgccacatttggaaatgcaacagaaatgatcatatcgatttatgcattgaagaatggaatgattagggttgttcaacaatcgttgttggggtcaatcttgtcaaacatgctcttagttctgggttgtgcctttttctctggtgggattgttcattacaataaagttcaggtgttcaacaagtcggctgccgtcgtgaattctggattgttgttgatggctgtaatggggataatgtttccagctgtgcttcattttacacgcacagaggtgcattttgggaagtcagagttggctctttcaagatttagtagctgtataatgcttgtggcatatgcaagctaccttttctttcaacttagaagtcatcgtagtctttataaccccatcaatgaggaaggagacaatgatcaagattgtgatgaggatgagattcctgagataactcactgggaagcaattggctggctttctgttttaactgtgtgggtgtccattttgtccggataccttgtcgatgccatccagggagcatcagactctttcaacattcctgtggcatttatcagtgtcattttgctccctattgtaggaaatgctgcagagcatgcaagtgctatcatgtttgccatgaaagataagcttgacattacacttggagttgcgattggatcatcgacgcaaatatccatgtttgtgattcccttctgtgtggttgttgggtggatcatgggagagccaatggacttgaattttcaactctttgagactgctacactctttatcaccgtgcttgtagtggcatttatgttgcaggaagggacgtcaaactacttcaaaggattgatgcttatcctgtgttatctcatagttgcagccagtttttttgtacatgtagatccttcaaatgatgctaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0009705 GO:0016020 GO:0031090 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Na_Ca_ex

Protein Analysis

516

Amino Acids

56.63

Weight (kDa)

5.9

Isoelectric Point (pI)

40.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003474)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g37510 FvH4_6g37510
malus_domestica	MD09G1157100.v1.1 MD17G1143500.v1.1
prunus_persica	Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1 Prupe.3G168500_v2.0.a1
pyrus_communis	pycom09g07580 pycom09g07590 pycom17g13660
rosa_chinensis	RchiOBHm_Chr2g0150371 RchiOBHm_Chr2g0150391 RchiOBHm_Chr7g0199401
rosa_laevigata	RLG00000020493 RLG00000020495
rosa_multiflora	Rmu_sc0002179.1_g000009 Rmu_ssc0000480.1_g000006
rosa_roxburghii	Rroxscaffold_2G00097160 Rroxscaffold_2G00097180
rosa_rugosa	Rorug02G0421000 Rorug02G0421000 Rorug02G0421000 Rorug02G0421100
rosa_samantha	Rh2AG480100 Rh2AG480300 Rh2CG466400 Rh2CG466600 Rh2DG501100 Rh5DG402100
rosa_wichuraiana	Rw2G039180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1011
AatII	GACGTC	1 cut(s)	1457
AccB7I	CCANNNNNTGG	1 cut(s)	617
AccI	GTMKAC	1 cut(s)	276
AccII	CGCG	1 cut(s)	370
AccIII	TCCGGA	1 cut(s)	1133
AciI	CCGC	1 cut(s)	370
AclWI	GGATC	4 cut(s)	292, 1309, 1364, 1523
AcoI	YGGCCR	2 cut(s)	195, 371
AcsI	RAATTY	2 cut(s)	829, 1381
AcuI	CTGAAG	1 cut(s)	520
AcyI	GRCGYC	1 cut(s)	1454
AfaI	GTAC	1 cut(s)	1521
AfiI	CCNNNNNNNGG	2 cut(s)	617, 1220
AflIII	ACRYGT	2 cut(s)	462, 1522
AjnI	CCWGG	1 cut(s)	1155
AjuI	GAANNNNNNNTTGG	2 cut(s)	905, 937
AleI	CACNNNNGTG	1 cut(s)	899
AluBI	AGCT	8 cut(s)	6, 309, 320, 540, 875, 945, 972, 1273
AluI	AGCT	8 cut(s)	6, 309, 320, 540, 875, 945, 972, 1273
Alw26I	GTCTC	3 cut(s)	120, 1026, 1391
AlwI	GGATC	4 cut(s)	292, 1309, 1364, 1523
Aor13HI	TCCGGA	1 cut(s)	1133
AoxI	GGCC	4 cut(s)	195, 336, 371, 608
ApeKI	GCWGC	4 cut(s)	317, 818, 1229, 1505
ApoI	RAATTY	2 cut(s)	829, 1381
AspS9I	GGNCC	2 cut(s)	479, 608
AsuHPI	GGTGA	1 cut(s)	1408
AvaII	GGWCC	1 cut(s)	479
BalI	TGGCCA	1 cut(s)	197
BbsI	GAAGAC	1 cut(s)	50
BbvI	GCAGC	4 cut(s)	329, 805, 1216, 1517
BccI	CCATC	8 cut(s)	105, 127, 247, 346, 516, 841, 1025, 1160
BceAI	ACGGC	2 cut(s)	404, 806
BcgI	CGANNNNNNTGC	2 cut(s)	13, 47
BciT130I	CCWGG	1 cut(s)	1157
BciVI	GTATCC	1 cut(s)	1130
BclI	TGATCA	3 cut(s)	217, 660, 1039
BcoDI	GTCTC	3 cut(s)	120, 1026, 1391
BfaI	CTAG	1 cut(s)	572
BfmI	CTRYAG	1 cut(s)	1230
BfuI	GTATCC	1 cut(s)	1130
BglI	GCCNNNNNGGC	1 cut(s)	370
BisI	GCNGC	5 cut(s)	318, 371, 819, 1230, 1506
BlsI	GCNGC	5 cut(s)	319, 372, 820, 1231, 1507
Bme1390I	CCNGG	1 cut(s)	1157
Bme18I	GGWCC	1 cut(s)	479
BmgT120I	GGNCC	2 cut(s)	479, 608
BmiI	GGNNCC	1 cut(s)	259
BmrFI	CCNGG	1 cut(s)	1157
BmrI	ACTGGG	1 cut(s)	1090
BmsI	GCATC	5 cut(s)	558, 1138, 1172, 1467, 1531
BmuI	ACTGGG	1 cut(s)	1090
BpiI	GAAGAC	1 cut(s)	50
Bsa29I	ATCGAT	1 cut(s)	668
BsaBI	GATNNNNATC	1 cut(s)	1481
BsaHI	GRCGYC	1 cut(s)	1454
BsaJI	CCNNGG	2 cut(s)	339, 1156
BsaWI	WCCGGW	1 cut(s)	1133
Bsc4I	CCNNNNNNNGG	2 cut(s)	617, 1220
Bse118I	RCCGGY	1 cut(s)	83
Bse1I	ACTGG	5 cut(s)	374, 489, 514, 1085, 1509
Bse8I	GATNNNNATC	1 cut(s)	1481
BseAI	TCCGGA	1 cut(s)	1133
BseBI	CCWGG	1 cut(s)	1157
BseCI	ATCGAT	1 cut(s)	668
BseDI	CCNNGG	2 cut(s)	339, 1156
BseGI	GGATG	4 cut(s)	417, 527, 1063, 1152
BseJI	GATNNNNATC	1 cut(s)	1481
BseLI	CCNNNNNNNGG	2 cut(s)	617, 1220
BseMII	CTCAG	3 cut(s)	240, 576, 1059
BseNI	ACTGG	5 cut(s)	374, 489, 514, 1085, 1509
BseRI	GAGGAG	2 cut(s)	308, 439
BseXI	GCAGC	4 cut(s)	329, 805, 1216, 1517
Bsh1236I	CGCG	1 cut(s)	370
BshFI	GGCC	4 cut(s)	197, 338, 373, 610
BshVI	ATCGAT	1 cut(s)	668
BsiSI	CCGG	2 cut(s)	84, 1134
BslFI	GGGAC	3 cut(s)	28, 636, 1465
BslI	CCNNNNNNNGG	2 cut(s)	617, 1220
BsmAI	GTCTC	3 cut(s)	120, 1026, 1391
BsmFI	GGGAC	3 cut(s)	28, 636, 1465
BsmI	GAATGC	1 cut(s)	87
BsnI	GGCC	4 cut(s)	197, 338, 373, 610
Bsp13I	TCCGGA	1 cut(s)	1133
Bsp1407I	TGTACA	1 cut(s)	1519
Bsp143I	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
BspACI	CCGC	1 cut(s)	370
BspANI	GGCC	4 cut(s)	197, 338, 373, 610
BspCNI	CTCAG	3 cut(s)	241, 577, 1060
BspDI	ATCGAT	1 cut(s)	668
BspEI	TCCGGA	1 cut(s)	1133
BspFNI	CGCG	1 cut(s)	370
BspLI	GGNNCC	1 cut(s)	259
BspMAI	CTGCAG	1 cut(s)	1234
BspPI	GGATC	4 cut(s)	292, 1309, 1364, 1523
BsrFI	RCCGGY	1 cut(s)	83
BsrGI	TGTACA	1 cut(s)	1519
BsrI	ACTGG	5 cut(s)	374, 489, 514, 1085, 1509
BssAI	RCCGGY	1 cut(s)	83
BssECI	CCNNGG	2 cut(s)	339, 1156
BssMI	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
BssNI	GRCGYC	1 cut(s)	1454
BssT1I	CCWWGG	1 cut(s)	339
Bst2UI	CCWGG	1 cut(s)	1157
Bst4CI	ACNGT	4 cut(s)	71, 616, 1114, 1420
BstACI	GRCGYC	1 cut(s)	1454
BstAPI	GCANNNNNTGC	1 cut(s)	1238
BstAUI	TGTACA	1 cut(s)	1519
BstC8I	GCNNGC	4 cut(s)	85, 970, 1097, 1239
BstDEI	CTNAG	5 cut(s)	249, 585, 745, 989, 1068
BstENI	CCTNNNNNAGG	1 cut(s)	1218
BstF5I	GGATG	4 cut(s)	417, 527, 1063, 1152
BstFNI	CGCG	1 cut(s)	370
BstKTI	GATC	9 cut(s)	150, 220, 300, 459, 663, 1042, 1304, 1359, 1531
BstMAI	GTCTC	3 cut(s)	120, 1026, 1391
BstMBI	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
BstMWI	GCNNNNNNNGC	5 cut(s)	93, 370, 379, 546, 1238
BstNI	CCWGG	1 cut(s)	1157
BstNSI	RCATGY	4 cut(s)	466, 742, 1241, 1526
BstSCI	CCNGG	1 cut(s)	1155
BstSFI	CTRYAG	1 cut(s)	1230
BstUI	CGCG	1 cut(s)	370
BstV1I	GCAGC	4 cut(s)	329, 805, 1216, 1517
BstV2I	GAAGAC	1 cut(s)	50
BstX2I	RGATCY	2 cut(s)	297, 1528
BstXI	CCANNNNNNTGG	1 cut(s)	390
BstYI	RGATCY	2 cut(s)	297, 1528
Bsu15I	ATCGAT	1 cut(s)	668
BsuI	GTATCC	1 cut(s)	1130
BsuRI	GGCC	4 cut(s)	197, 338, 373, 610
BsuTUI	ATCGAT	1 cut(s)	668
BtsCI	GGATG	4 cut(s)	417, 527, 1063, 1152
BtsIMutI	CAGTG	3 cut(s)	482, 1078, 1204
Cac8I	GCNNGC	4 cut(s)	85, 970, 1097, 1239
Cfr10I	RCCGGY	1 cut(s)	83
Cfr13I	GGNCC	2 cut(s)	479, 608
ClaI	ATCGAT	1 cut(s)	668
CseI	GACGC	2 cut(s)	557, 1318
Csp6I	GTAC	1 cut(s)	1520
CviQI	GTAC	1 cut(s)	1520
DdeI	CTNAG	5 cut(s)	249, 585, 745, 989, 1068
DpnI	GATC	9 cut(s)	149, 219, 299, 458, 662, 1041, 1303, 1358, 1530
DpnII	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
DraI	TTTAAA	1 cut(s)	630
EaeI	YGGCCR	2 cut(s)	195, 371
Eco130I	CCWWGG	1 cut(s)	339
Eco147I	AGGCCT	1 cut(s)	338
Eco47I	GGWCC	1 cut(s)	479
Eco57I	CTGAAG	1 cut(s)	520
EcoNI	CCTNNNNNAGG	1 cut(s)	1218
EcoRI	GAATTC	1 cut(s)	829
EcoRII	CCWGG	1 cut(s)	1155
EcoT14I	CCWWGG	1 cut(s)	339
EcoT22I	ATGCAT	1 cut(s)	679
ErhI	CCWWGG	1 cut(s)	339
FalI	AAGNNNNNCTT	3 cut(s)	35, 1257, 1289
FaqI	GGGAC	3 cut(s)	28, 636, 1465
FauNDI	CATATG	1 cut(s)	964
FbaI	TGATCA	3 cut(s)	217, 660, 1039
FblI	GTMKAC	1 cut(s)	276
Fnu4HI	GCNGC	5 cut(s)	318, 371, 819, 1230, 1506
FokI	GGATG	4 cut(s)	424, 534, 1070, 1139
Fsp4HI	GCNGC	5 cut(s)	318, 371, 819, 1230, 1506
FspBI	CTAG	1 cut(s)	572
GluI	GCNGC	5 cut(s)	318, 371, 819, 1230, 1506
HaeIII	GGCC	4 cut(s)	197, 338, 373, 610
HapII	CCGG	2 cut(s)	84, 1134
HgaI	GACGC	2 cut(s)	557, 1318
Hin1I	GRCGYC	1 cut(s)	1454
HindIII	AAGCTT	1 cut(s)	1271
HinfI	GANTC	5 cut(s)	113, 284, 1063, 1169, 1330
HpaII	CCGG	2 cut(s)	84, 1134
HphI	GGTGA	1 cut(s)	1408
Hpy166II	GTNNAC	3 cut(s)	47, 277, 482
Hpy188I	TCNGA	6 cut(s)	152, 191, 250, 289, 919, 1168
Hpy188III	TCNNGA	6 cut(s)	826, 834, 933, 1043, 1067, 1134
Hpy8I	GTNNAC	3 cut(s)	47, 277, 482
Hpy99I	CGWCG	2 cut(s)	827, 1312
HpyAV	CCTTC	7 cut(s)	5, 40, 375, 1022, 1345, 1442, 1542
HpyCH4III	ACNGT	4 cut(s)	71, 616, 1114, 1420
HpyCH4IV	ACGT	2 cut(s)	504, 1454
HpyCH4V	TGCA	9 cut(s)	398, 650, 677, 904, 968, 1232, 1241, 1444, 1505
HpyF10VI	GCNNNNNNNGC	5 cut(s)	93, 370, 379, 546, 1238
HpyF3I	CTNAG	5 cut(s)	249, 585, 745, 989, 1068
HpySE526I	ACGT	2 cut(s)	504, 1454
Hsp92I	GRCGYC	1 cut(s)	1454
Kpn2I	TCCGGA	1 cut(s)	1133
KroI	GCCGGC	1 cut(s)	83
KroNI	GCCGGC	1 cut(s)	85
Ksp22I	TGATCA	3 cut(s)	217, 660, 1039
Kzo9I	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
LmnI	GCTCC	4 cut(s)	152, 257, 1160, 1215
Lsp1109I	GCAGC	4 cut(s)	329, 805, 1216, 1517
LweI	GCATC	5 cut(s)	558, 1138, 1172, 1467, 1531
MaeI	CTAG	1 cut(s)	572
MaeII	ACGT	2 cut(s)	504, 1454
MaeIII	GTNAC	1 cut(s)	505
MalI	GATC	9 cut(s)	149, 219, 299, 458, 662, 1041, 1303, 1358, 1530
MboI	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
MboII	GAAGA	6 cut(s)	50, 117, 120, 220, 526, 694
MfeI	CAATTG	1 cut(s)	1089
MflI	RGATCY	2 cut(s)	297, 1528
MlsI	TGGCCA	1 cut(s)	197
MluCI	AATT	3 cut(s)	829, 1089, 1381
MluNI	TGGCCA	1 cut(s)	197
MlyI	GAGTC	2 cut(s)	122, 1163
MnlI	CCTC	6 cut(s)	286, 328, 417, 892, 1018, 1048
Mox20I	TGGCCA	1 cut(s)	197
Mph1103I	ATGCAT	1 cut(s)	679
MroI	TCCGGA	1 cut(s)	1133
MroNI	GCCGGC	1 cut(s)	83
MscI	TGGCCA	1 cut(s)	197
MseI	TTAA	4 cut(s)	41, 446, 629, 1109
MslI	CAYNNNNRTG	4 cut(s)	899, 1184, 1242, 1325
Msp20I	TGGCCA	1 cut(s)	197
MspA1I	CMGCKG	1 cut(s)	875
MspI	CCGG	2 cut(s)	84, 1134
MspR9I	CCNGG	1 cut(s)	1157
MunI	CAATTG	1 cut(s)	1089
Mva1269I	GAATGC	1 cut(s)	87
MvaI	CCWGG	1 cut(s)	1157
MvnI	CGCG	1 cut(s)	370
MwoI	GCNNNNNNNGC	5 cut(s)	93, 370, 379, 546, 1238
NaeI	GCCGGC	1 cut(s)	85
NdeI	CATATG	1 cut(s)	964
NdeII	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
NgoMIV	GCCGGC	1 cut(s)	83
NlaIV	GGNNCC	1 cut(s)	259
NsiI	ATGCAT	1 cut(s)	679
NspI	RCATGY	4 cut(s)	466, 742, 1241, 1526
OliI	CACNNNNGTG	1 cut(s)	899
PaeI	GCATGC	1 cut(s)	1241
PceI	AGGCCT	1 cut(s)	338
PciI	ACATGT	2 cut(s)	462, 1522
PctI	GAATGC	1 cut(s)	87
PdiI	GCCGGC	1 cut(s)	85
PfeI	GAWTC	3 cut(s)	284, 1063, 1330
PflMI	CCANNNNNTGG	1 cut(s)	617
PkrI	GCNGC	5 cut(s)	319, 372, 820, 1231, 1507
PleI	GAGTC	2 cut(s)	121, 1163
PpsI	GAGTC	2 cut(s)	121, 1163
PscI	ACATGT	2 cut(s)	462, 1522
PsiI	TTATAA	1 cut(s)	1011
Psp6I	CCWGG	1 cut(s)	1155
PspGI	CCWGG	1 cut(s)	1155
PspN4I	GGNNCC	1 cut(s)	259
PspPI	GGNCC	2 cut(s)	479, 608
PstI	CTGCAG	1 cut(s)	1234
PsuI	RGATCY	2 cut(s)	297, 1528
PvuII	CAGCTG	1 cut(s)	875
RsaI	GTAC	1 cut(s)	1521
RsaNI	GTAC	1 cut(s)	1520
RseI	CAYNNNNRTG	4 cut(s)	899, 1184, 1242, 1325
SaqAI	TTAA	4 cut(s)	41, 446, 629, 1109
SatI	GCNGC	5 cut(s)	318, 371, 819, 1230, 1506
Sau3AI	GATC	9 cut(s)	147, 217, 297, 456, 660, 1039, 1301, 1356, 1528
Sau96I	GGNCC	2 cut(s)	479, 608
SchI	GAGTC	2 cut(s)	122, 1163
ScrFI	CCNGG	1 cut(s)	1157
SfaNI	GCATC	5 cut(s)	558, 1138, 1172, 1467, 1531
SfcI	CTRYAG	1 cut(s)	1230
SinI	GGWCC	1 cut(s)	479
SmiMI	CAYNNNNRTG	4 cut(s)	899, 1184, 1242, 1325
SphI	GCATGC	1 cut(s)	1241
Sse9I	AATT	3 cut(s)	829, 1089, 1381
SseBI	AGGCCT	1 cut(s)	338
SsiI	CCGC	1 cut(s)	370
SspI	AATATT	1 cut(s)	143
SspMI	CTAG	1 cut(s)	572
StuI	AGGCCT	1 cut(s)	338
StyD4I	CCNGG	1 cut(s)	1155
StyI	CCWWGG	1 cut(s)	339
TaaI	ACNGT	4 cut(s)	71, 616, 1114, 1420
TaiI	ACGT	2 cut(s)	507, 1457
TaqI	TCGA	3 cut(s)	668, 1146, 1307
TasI	AATT	3 cut(s)	829, 1089, 1381
TatI	WGTACW	1 cut(s)	1519
TauI	GCSGC	1 cut(s)	373
TfiI	GAWTC	3 cut(s)	284, 1063, 1330
Tru1I	TTAA	4 cut(s)	41, 446, 629, 1109
Tru9I	TTAA	4 cut(s)	41, 446, 629, 1109
TscAI	CASTG	3 cut(s)	489, 1085, 1204
TseI	GCWGC	4 cut(s)	317, 818, 1229, 1505
TspDTI	ATGAA	5 cut(s)	120, 347, 773, 872, 1277
TspRI	CASTG	3 cut(s)	489, 1085, 1204
Van91I	CCANNNNNTGG	1 cut(s)	617
VpaK11BI	GGWCC	1 cut(s)	479
XagI	CCTNNNNNAGG	1 cut(s)	1218
XapI	RAATTY	2 cut(s)	829, 1381
XceI	RCATGY	4 cut(s)	466, 742, 1241, 1526
XcmI	CCANNNNNNNNNTGG	1 cut(s)	190
XmiI	GTMKAC	1 cut(s)	276
XspI	CTAG	1 cut(s)	572
ZraI	GACGTC	1 cut(s)	1455
Zsp2I	ATGCAT	1 cut(s)	679

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.