Rh5DG402100

Belongs to the Ca(2 ) cation antiporter (CaCA) (TC 2.A.19) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
63721882 .. 63723047
1166 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG402100.1

Sequence Viewer

Length: 333 bp
ATGATCAATGGGTTTTTCCAGGAAGCATCTGACTCGCTCAATATTCCTGTAGCATTTATTAGTGCCATCCTGCTCCCAGTTGTAGGAAATATGTGGTCTATCCTGTTTTCCATGAGAGAAAAACTTGACCTCACGCTTGGAGTCGCTATTGGATTATCTATACAAACATCCATGTTTACAATCCCCTTTTGTGTAATTGTTGGGTGGATAATAGGAAATCCTATGGACTTGAATTTTCAACTCTTTGAGACTGTTATATTGGTTATGGCTGTGCTAGTAGTGGCATTTATGTTGCAGGTTTGTGTATTATTTCTTGTTTTTACTTCCTTTTAG

Protein Analysis

110

Amino Acids

12.18

Weight (kDa)

4.05

Isoelectric Point (pI)

23.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Na_Ca_ex PF01699 10 - 98 5.9e-07 Sodium/calcium exchanger protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 286
AcsI RAATTY 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 2 cut(s) 232, 239
AjnI CCWGG 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 242
ApoI RAATTY 1 cut(s) 232
BccI CCATC 1 cut(s) 74
BcgI CGANNNNNNTGC 2 cut(s) 15, 49
BciT130I CCWGG 1 cut(s) 20
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 242
BfaI CTAG 1 cut(s) 275
BfmI CTRYAG 1 cut(s) 48
BfuAI ACCTGC 1 cut(s) 286
Bme1390I CCNGG 1 cut(s) 20
BmrFI CCNGG 1 cut(s) 20
BmrI ACTGGG 1 cut(s) 71
BmsI GCATC 1 cut(s) 35
BmuI ACTGGG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse1I ACTGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 20
BseGI GGATG 2 cut(s) 66, 167
BseLI CCNNNNNNNGG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 242
Bsp143I GATC 1 cut(s) 3
BspMI ACCTGC 1 cut(s) 286
BsrI ACTGG 1 cut(s) 77
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 1 cut(s) 20
Bst4CI ACNGT 1 cut(s) 253
BstF5I GGATG 2 cut(s) 66, 167
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 242
BstMBI GATC 1 cut(s) 3
BstNI CCWGG 1 cut(s) 20
BstSCI CCNGG 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 48
BtsCI GGATG 2 cut(s) 66, 167
BveI ACCTGC 1 cut(s) 286
CviAII CATG 2 cut(s) 112, 172
CviJI RGCY 1 cut(s) 269
CviKI_1 RGCY 1 cut(s) 269
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EcoRII CCWGG 1 cut(s) 18
FaeI CATG 2 cut(s) 115, 175
FaiI YATR 8 cut(s) 92, 113, 161, 173, 224, 257, 266, 290
FatI CATG 2 cut(s) 111, 171
FbaI TGATCA 1 cut(s) 3
FokI GGATG 2 cut(s) 53, 154
FspBI CTAG 1 cut(s) 275
Hin1II CATG 2 cut(s) 115, 175
HinfI GANTC 2 cut(s) 32, 141
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 177
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4V TGCA 1 cut(s) 295
Hsp92II CATG 2 cut(s) 115, 175
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 7 cut(s) 5, 32, 60, 83, 90, 116, 281
LweI GCATC 1 cut(s) 35
MaeI CTAG 1 cut(s) 275
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MluCI AATT 2 cut(s) 195, 232
MlyI GAGTC 2 cut(s) 26, 150
MnlI CCTC 1 cut(s) 140
MspR9I CCNGG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 20
NdeII GATC 1 cut(s) 3
NlaIII CATG 2 cut(s) 115, 175
PfoI TCCNGGA 1 cut(s) 18
PleI GAGTC 2 cut(s) 26, 149
PpsI GAGTC 2 cut(s) 26, 149
Psp6I CCWGG 1 cut(s) 18
PspGI CCWGG 1 cut(s) 18
Sau3AI GATC 1 cut(s) 3
SchI GAGTC 2 cut(s) 26, 150
ScrFI CCNGG 1 cut(s) 20
SetI ASST 2 cut(s) 132, 300
SfaNI GCATC 1 cut(s) 35
SfcI CTRYAG 1 cut(s) 48
Sse9I AATT 2 cut(s) 195, 232
SspI AATATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 275
StyD4I CCNGG 1 cut(s) 18
TaaI ACNGT 1 cut(s) 253
TasI AATT 2 cut(s) 195, 232
XapI RAATTY 1 cut(s) 232
XspI CTAG 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.