Rroxscaffold_1G00031910

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
45207149 .. 45212629
5481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00031910.1

Sequence Viewer

Length: 249 bp
ATGGATCTGATCAGATTGAAAATGAAAAGAGAGGAGGAGGTCCAAGATATCCACCATCTTATTAGATCGAAAAATCCGATTGGCACTAAAAAGGGAATTTTCTTTGATTCTCTCGATTCAAGAGTTTTTAACTCAAGATACTTACATGGATCTAAAGAGGAGGAAAAAGGATTGTTTGCTACAGGCAGCAAGCTCGGTGGTGGTCCGACGGCGGAGAACCCGTCGGATCCCGATTCTAGGTCGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.23

Weight (kDa)

9.05

Isoelectric Point (pI)

58.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 212
AclWI GGATC 4 cut(s) 12, 157, 221, 234
AcsI RAATTY 1 cut(s) 96
AfiI CCNNNNNNNGG 1 cut(s) 237
AgsI TTSAA 2 cut(s) 19, 120
AluBI AGCT 1 cut(s) 193
AluI AGCT 1 cut(s) 193
AlwI GGATC 4 cut(s) 12, 157, 221, 234
ApeKI GCWGC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 96
AspS9I GGNCC 2 cut(s) 40, 203
AvaII GGWCC 2 cut(s) 40, 203
BamHI GGATCC 1 cut(s) 226
BbvI GCAGC 1 cut(s) 198
BccI CCATC 1 cut(s) 63
BceAI ACGGC 1 cut(s) 225
BcgI CGANNNNNNTGC 2 cut(s) 175, 209
BclI TGATCA 1 cut(s) 9
BfaI CTAG 1 cut(s) 237
BfmI CTRYAG 1 cut(s) 180
BisI GCNGC 1 cut(s) 187
BlsI GCNGC 1 cut(s) 188
Bme18I GGWCC 2 cut(s) 40, 203
BmgT120I GGNCC 2 cut(s) 40, 203
BmiI GGNNCC 1 cut(s) 228
BpuEI CTTGAG 1 cut(s) 118
BsaXI ACNNNNNCTCC 2 cut(s) 206, 236
Bsc4I CCNNNNNNNGG 1 cut(s) 237
BseLI CCNNNNNNNGG 1 cut(s) 237
BseRI GAGGAG 3 cut(s) 47, 50, 173
BseXI GCAGC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 237
Bsp143I GATC 5 cut(s) 4, 9, 65, 149, 226
BspACI CCGC 1 cut(s) 212
BspLI GGNNCC 1 cut(s) 228
BspPI GGATC 4 cut(s) 12, 157, 221, 234
BssMI GATC 5 cut(s) 4, 9, 65, 149, 226
BstC8I GCNNGC 1 cut(s) 191
BstKTI GATC 5 cut(s) 7, 12, 68, 152, 229
BstMBI GATC 5 cut(s) 4, 9, 65, 149, 226
BstSFI CTRYAG 1 cut(s) 180
BstV1I GCAGC 1 cut(s) 198
BstX2I RGATCY 3 cut(s) 4, 149, 226
BstYI RGATCY 3 cut(s) 4, 149, 226
Cac8I GCNNGC 1 cut(s) 191
Cfr13I GGNCC 2 cut(s) 40, 203
CspCI CAANNNNNGTGG 2 cut(s) 178, 213
CviAII CATG 1 cut(s) 146
CviJI RGCY 1 cut(s) 193
CviKI_1 RGCY 1 cut(s) 193
DpnI GATC 5 cut(s) 6, 11, 67, 151, 228
DpnII GATC 5 cut(s) 4, 9, 65, 149, 226
EciI GGCGGA 1 cut(s) 227
Eco32I GATATC 1 cut(s) 49
Eco47I GGWCC 2 cut(s) 40, 203
EcoRV GATATC 1 cut(s) 49
FaeI CATG 1 cut(s) 149
FaiI YATR 1 cut(s) 147
FatI CATG 1 cut(s) 145
FbaI TGATCA 1 cut(s) 9
Fnu4HI GCNGC 1 cut(s) 187
Fsp4HI GCNGC 1 cut(s) 187
FspBI CTAG 1 cut(s) 237
GluI GCNGC 1 cut(s) 187
Hin1II CATG 1 cut(s) 149
HinfI GANTC 3 cut(s) 107, 116, 233
Hpy188I TCNGA 5 cut(s) 9, 14, 78, 207, 226
Hpy188III TCNNGA 4 cut(s) 113, 120, 135, 230
Hpy99I CGWCG 2 cut(s) 211, 226
Hsp92II CATG 1 cut(s) 149
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 5 cut(s) 4, 9, 65, 149, 226
LpnPI CCDG 1 cut(s) 168
Lsp1109I GCAGC 1 cut(s) 198
MaeI CTAG 1 cut(s) 237
MalI GATC 5 cut(s) 6, 11, 67, 151, 228
MboI GATC 5 cut(s) 4, 9, 65, 149, 226
MflI RGATCY 3 cut(s) 4, 149, 226
MluCI AATT 1 cut(s) 96
MmeI TCCRAC 2 cut(s) 204, 230
MnlI CCTC 5 cut(s) 25, 28, 31, 151, 154
MseI TTAA 1 cut(s) 129
NdeII GATC 5 cut(s) 4, 9, 65, 149, 226
NlaIII CATG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 228
PcsI WCGNNNNNNNCGW 1 cut(s) 74
PfeI GAWTC 3 cut(s) 107, 116, 233
PkrI GCNGC 1 cut(s) 188
PspN4I GGNNCC 1 cut(s) 228
PspPI GGNCC 2 cut(s) 40, 203
PsuI RGATCY 3 cut(s) 4, 149, 226
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 1 cut(s) 187
Sau3AI GATC 5 cut(s) 4, 9, 65, 149, 226
Sau96I GGNCC 2 cut(s) 40, 203
SetI ASST 3 cut(s) 42, 195, 242
SfcI CTRYAG 1 cut(s) 180
SinI GGWCC 2 cut(s) 40, 203
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
Sse9I AATT 1 cut(s) 96
SsiI CCGC 1 cut(s) 212
SspMI CTAG 1 cut(s) 237
TaqI TCGA 3 cut(s) 68, 114, 242
TasI AATT 1 cut(s) 96
TfiI GAWTC 3 cut(s) 107, 116, 233
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TseI GCWGC 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 38
VpaK11BI GGWCC 2 cut(s) 40, 203
XapI RAATTY 1 cut(s) 96
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.