Rroxscaffold_2G00125400

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
60166989 .. 60167679
691 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00125400.1

Sequence Viewer

Length: 231 bp
ATGGCTGCAGCTTTGTCAAAACTGGTGTGCTGTAGTTGTTGTAAAGGAATGGTGGCTGCAACCTTGTCAAAATTGGTGGATACAAAGCTTCAGCTTTTCAAGAGTATTGTGCTGCAACTGCAGGCAAAGTTTGGTGTCTTGCAACTTTGCCAAGTTAGGTGTGCTGCCACTTCAGTTAAAGAGTATCAGATTCTCGGGCTGCTTGACCTTTCTGTACTAATTCGGCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.19

Weight (kDa)

9.24

Isoelectric Point (pI)

24.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 224
AcuI CTGAAG 2 cut(s) 74, 156
AfaI GTAC 1 cut(s) 216
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 3 cut(s) 11, 88, 94
AluI AGCT 3 cut(s) 11, 88, 94
Ama87I CYCGRG 1 cut(s) 194
AoxI GGCC 1 cut(s) 224
ApeKI GCWGC 6 cut(s) 5, 8, 56, 112, 164, 199
AvaI CYCGRG 1 cut(s) 194
BbvI GCAGC 5 cut(s) 20, 43, 99, 151, 186
BciVI GTATCC 1 cut(s) 73
BfmI CTRYAG 3 cut(s) 6, 31, 119
BfuI GTATCC 1 cut(s) 73
BisI GCNGC 6 cut(s) 6, 9, 57, 113, 165, 200
BlsI GCNGC 6 cut(s) 7, 10, 58, 114, 166, 201
BmeT110I CYCGRG 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 27
BseNI ACTGG 1 cut(s) 27
BseXI GCAGC 5 cut(s) 20, 43, 99, 151, 186
BshFI GGCC 1 cut(s) 226
BsiHKCI CYCGRG 1 cut(s) 194
BsnI GGCC 1 cut(s) 226
BsoBI CYCGRG 1 cut(s) 194
BspANI GGCC 1 cut(s) 226
BspMAI CTGCAG 2 cut(s) 10, 123
BsrI ACTGG 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 123
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstSFI CTRYAG 3 cut(s) 6, 31, 119
BstV1I GCAGC 5 cut(s) 20, 43, 99, 151, 186
BsuI GTATCC 1 cut(s) 73
BsuRI GGCC 1 cut(s) 226
Cac8I GCNNGC 1 cut(s) 123
Csp6I GTAC 1 cut(s) 215
CspCI CAANNNNNGTGG 2 cut(s) 57, 92
CviJI RGCY 7 cut(s) 5, 11, 56, 88, 94, 199, 226
CviKI_1 RGCY 7 cut(s) 5, 11, 56, 88, 94, 199, 226
CviQI GTAC 1 cut(s) 215
EaeI YGGCCR 1 cut(s) 224
Eco57I CTGAAG 2 cut(s) 74, 156
Eco88I CYCGRG 1 cut(s) 194
FaiI YATR 1 cut(s) 229
Fnu4HI GCNGC 6 cut(s) 6, 9, 57, 113, 165, 200
Fsp4HI GCNGC 6 cut(s) 6, 9, 57, 113, 165, 200
GluI GCNGC 6 cut(s) 6, 9, 57, 113, 165, 200
HaeIII GGCC 1 cut(s) 226
HindIII AAGCTT 1 cut(s) 86
HinfI GANTC 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 1 cut(s) 100
HpyCH4V TGCA 5 cut(s) 8, 59, 115, 121, 142
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
LpnPI CCDG 2 cut(s) 8, 107
Lsp1109I GCAGC 5 cut(s) 20, 43, 99, 151, 186
MluCI AATT 2 cut(s) 71, 219
MseI TTAA 1 cut(s) 177
MwoI GCNNNNNNNGC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 190
PkrI GCNGC 6 cut(s) 7, 10, 58, 114, 166, 201
PstI CTGCAG 2 cut(s) 10, 123
RsaI GTAC 1 cut(s) 216
RsaNI GTAC 1 cut(s) 215
SaqAI TTAA 1 cut(s) 177
SatI GCNGC 6 cut(s) 6, 9, 57, 113, 165, 200
SetI ASST 6 cut(s) 13, 65, 90, 96, 161, 210
SfcI CTRYAG 3 cut(s) 6, 31, 119
SgeI CNNG 9 cut(s) 35, 76, 112, 134, 151, 164, 206, 208, 215
Sse9I AATT 2 cut(s) 71, 219
TasI AATT 2 cut(s) 71, 219
TatI WGTACW 1 cut(s) 214
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TseI GCWGC 6 cut(s) 5, 8, 56, 112, 164, 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.