Rroxscaffold_7G00208230

conserved protein UCP009193

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
58217138 .. 58221833
4696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00208230.1

Sequence Viewer

Length: 225 bp
ATGAAGAGGGGAAACAAAACGGTCTTCGAGGAGGATAAAATTTATCGGTGGATCTGTAGACAACAAGAAGGGGGATCTAGAGTTGCAACAGGCGATATACTCAACTACCTTCAGCAGAGTAAGTGTCGCAAAGATCTTTGCCTTCGCAAAAGTGGTCAGCGACGGCATTTTGCCGTGGCTAAAAATATTGGCGACGCCACCAACGGCGTCGAAGCTTTGCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.45

Weight (kDa)

9.78

Isoelectric Point (pI)

70.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 58
AclWI GGATC 2 cut(s) 59, 82
AcsI RAATTY 1 cut(s) 39
AcuI CTGAAG 1 cut(s) 95
AcyI GRCGYC 2 cut(s) 195, 207
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwI GGATC 2 cut(s) 59, 82
ApoI RAATTY 1 cut(s) 39
BbsI GAAGAC 1 cut(s) 16
BceAI ACGGC 4 cut(s) 158, 179, 205, 220
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 55
BglII AGATCT 1 cut(s) 133
BpiI GAAGAC 1 cut(s) 16
BsaHI GRCGYC 2 cut(s) 195, 207
BsaJI CCNNGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 44
Bsp143I GATC 3 cut(s) 51, 74, 133
BspPI GGATC 2 cut(s) 59, 82
BssECI CCNNGG 1 cut(s) 174
BssMI GATC 3 cut(s) 51, 74, 133
BssNI GRCGYC 2 cut(s) 195, 207
Bst4CI ACNGT 1 cut(s) 22
BstACI GRCGYC 2 cut(s) 195, 207
BstDSI CCRYGG 1 cut(s) 174
BstKTI GATC 3 cut(s) 54, 77, 136
BstMBI GATC 3 cut(s) 51, 74, 133
BstSFI CTRYAG 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 16
BstX2I RGATCY 3 cut(s) 51, 74, 133
BstYI RGATCY 3 cut(s) 51, 74, 133
BtgI CCRYGG 1 cut(s) 174
CseI GACGC 2 cut(s) 196, 203
CviJI RGCY 2 cut(s) 179, 215
CviKI_1 RGCY 2 cut(s) 179, 215
DpnI GATC 3 cut(s) 53, 76, 135
DpnII GATC 3 cut(s) 51, 74, 133
Eco57I CTGAAG 1 cut(s) 95
FaiI YATR 1 cut(s) 98
FblI GTMKAC 1 cut(s) 58
FspBI CTAG 1 cut(s) 78
HgaI GACGC 2 cut(s) 196, 203
Hin1I GRCGYC 2 cut(s) 195, 207
HindIII AAGCTT 1 cut(s) 213
Hpy166II GTNNAC 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 78
Hpy8I GTNNAC 1 cut(s) 59
Hpy99I CGWCG 3 cut(s) 165, 197, 212
HpyAV CCTTC 3 cut(s) 62, 119, 152
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 86
Hsp92I GRCGYC 2 cut(s) 195, 207
Kzo9I GATC 3 cut(s) 51, 74, 133
LpnPI CCDG 1 cut(s) 75
MaeI CTAG 1 cut(s) 78
MalI GATC 3 cut(s) 53, 76, 135
MboI GATC 3 cut(s) 51, 74, 133
MboII GAAGA 2 cut(s) 16, 16
MflI RGATCY 3 cut(s) 51, 74, 133
MluCI AATT 1 cut(s) 39
MnlI CCTC 2 cut(s) 22, 25
NdeII GATC 3 cut(s) 51, 74, 133
PsuI RGATCY 3 cut(s) 51, 74, 133
Sau3AI GATC 3 cut(s) 51, 74, 133
SetI ASST 2 cut(s) 111, 217
SfcI CTRYAG 1 cut(s) 55
SgeI CNNG 5 cut(s) 40, 77, 90, 102, 187
Sse9I AATT 1 cut(s) 39
SspI AATATT 1 cut(s) 187
SspMI CTAG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 2 cut(s) 27, 210
TasI AATT 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 39
XbaI TCTAGA 1 cut(s) 77
XmiI GTMKAC 1 cut(s) 58
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.