Rroxscaffold_7G00190290

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
30382479 .. 30391599
9121 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00190290.1

Sequence Viewer

Length: 288 bp
ATGAATGGAGTTGACTTCAATTTGCTCTGTGGACAATTCAAAGCACCGGGCCTGATCTATTCCTTCACATGGGGTAGCATGAAACCGTCGCAGAGTAAGTGTCGCAAAACTCTTTGCCGTCGCAAAAGTGGTCTGCGACGGCATTTTGCCGTGGCTAAAGATATTGGCGACGCCACCAACGGCGTCGAAGCTTTGCCGTCGCAGAGCCGTCGCAAATGCTTTTTTGCGACGGCAAAACAGCTTTTAGCTACGGCAGAGCGCCGTGGCTATTGCAATTTTTTTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.67

Weight (kDa)

10.2

Isoelectric Point (pI)

46.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 2 cut(s) 171, 183
AfiI CCNNNNNNNGG 1 cut(s) 69
AgsI TTSAA 2 cut(s) 19, 40
AluBI AGCT 3 cut(s) 191, 241, 248
AluI AGCT 3 cut(s) 191, 241, 248
AoxI GGCC 1 cut(s) 49
AspLEI GCGC 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 49
AsuC2I CCSGG 1 cut(s) 48
BceAI ACGGC 9 cut(s) 102, 134, 155, 181, 192, 196, 246, 246, 267
BcgI CGANNNNNNTGC 2 cut(s) 191, 225
BcnI CCSGG 1 cut(s) 48
BfoI RGCGCY 1 cut(s) 262
Bme1390I CCNGG 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 48
BpuMI CCSGG 1 cut(s) 48
BsaHI GRCGYC 2 cut(s) 171, 183
BsaJI CCNNGG 2 cut(s) 150, 262
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseDI CCNNGG 2 cut(s) 150, 262
BseLI CCNNNNNNNGG 1 cut(s) 69
BshFI GGCC 1 cut(s) 51
BsiSI CCGG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 69
BsnI GGCC 1 cut(s) 51
Bsp143I GATC 1 cut(s) 54
BspANI GGCC 1 cut(s) 51
BssECI CCNNGG 2 cut(s) 150, 262
BssMI GATC 1 cut(s) 54
BssNI GRCGYC 2 cut(s) 171, 183
Bst4CI ACNGT 1 cut(s) 87
BstACI GRCGYC 2 cut(s) 171, 183
BstDSI CCRYGG 2 cut(s) 150, 262
BstH2I RGCGCY 1 cut(s) 262
BstHHI GCGC 1 cut(s) 261
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 46
BsuRI GGCC 1 cut(s) 51
BtgI CCRYGG 2 cut(s) 150, 262
CfoI GCGC 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 49
CseI GACGC 2 cut(s) 172, 179
CviAII CATG 2 cut(s) 69, 79
CviJI RGCY 7 cut(s) 51, 155, 191, 207, 241, 248, 267
CviKI_1 RGCY 7 cut(s) 51, 155, 191, 207, 241, 248, 267
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
FaeI CATG 2 cut(s) 72, 82
FaiI YATR 2 cut(s) 70, 80
FatI CATG 2 cut(s) 68, 78
GlaI GCGC 1 cut(s) 260
HaeII RGCGCY 1 cut(s) 262
HaeIII GGCC 1 cut(s) 51
HapII CCGG 1 cut(s) 47
HgaI GACGC 2 cut(s) 172, 179
HhaI GCGC 1 cut(s) 261
Hin1I GRCGYC 2 cut(s) 171, 183
Hin1II CATG 2 cut(s) 72, 82
Hin6I GCGC 1 cut(s) 259
HinP1I GCGC 1 cut(s) 259
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
HindIII AAGCTT 1 cut(s) 189
HpaII CCGG 1 cut(s) 47
Hpy166II GTNNAC 2 cut(s) 13, 32
Hpy8I GTNNAC 2 cut(s) 13, 32
Hpy99I CGWCG 8 cut(s) 91, 123, 141, 173, 188, 202, 213, 232
HpyAV CCTTC 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 273
Hsp92I GRCGYC 2 cut(s) 171, 183
Hsp92II CATG 2 cut(s) 72, 82
HspAI GCGC 1 cut(s) 259
Kzo9I GATC 1 cut(s) 54
LpnPI CCDG 2 cut(s) 60, 65
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MluCI AATT 3 cut(s) 19, 35, 274
MspI CCGG 1 cut(s) 47
MspR9I CCNGG 1 cut(s) 48
NciI CCSGG 1 cut(s) 48
NdeII GATC 1 cut(s) 54
NlaIII CATG 2 cut(s) 72, 82
PspPI GGNCC 1 cut(s) 49
Sau3AI GATC 1 cut(s) 54
Sau96I GGNCC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 48
SetI ASST 3 cut(s) 193, 243, 250
SgeI CNNG 7 cut(s) 59, 60, 64, 81, 91, 163, 275
Sse9I AATT 3 cut(s) 19, 35, 274
StyD4I CCNGG 1 cut(s) 46
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 186
TasI AATT 3 cut(s) 19, 35, 274
TspDTI ATGAA 2 cut(s) 17, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.