Rroxscaffold_3G00243090

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
35645438 .. 35649622
4185 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00243090.1

Sequence Viewer

Length: 255 bp
ATGGCGACGGGCATTAGGGGTAGCATGAAACCGTCGCAGAGTAAGTGTCGCAAAGCTCTTTGCCGTCGCAAAAATAGTCTGCGACGGCATTTTGCCGTGGCTAAAGATATTGGCGACGCCACCAACGGCGTCGAAGCTTTGCCGTCGCAAATGCTTTTTGCGACGGCAAAAAACAGCTTTCGCTACGGCAGGGCACCCAGGGAGACTGACAAAGTTTCAAGTTTGCTTTGCAGAATCACACCCTCAACTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.27

Weight (kDa)

10.68

Isoelectric Point (pI)

41.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 193
AcyI GRCGYC 2 cut(s) 117, 129
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 1 cut(s) 197
AluBI AGCT 3 cut(s) 56, 137, 177
AluI AGCT 3 cut(s) 56, 137, 177
Alw26I GTCTC 1 cut(s) 197
BaeGI GKGCMC 1 cut(s) 196
BanI GGYRCC 1 cut(s) 193
BceAI ACGGC 7 cut(s) 48, 80, 101, 127, 142, 180, 202
BciT130I CCWGG 1 cut(s) 199
BcoDI GTCTC 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 199
BmiI GGNNCC 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 199
BsaHI GRCGYC 2 cut(s) 117, 129
BsaJI CCNNGG 3 cut(s) 96, 197, 198
BseBI CCWGG 1 cut(s) 199
BseDI CCNNGG 3 cut(s) 96, 197, 198
BseMII CTCAG 1 cut(s) 240
BseSI GKGCMC 1 cut(s) 196
BshNI GGYRCC 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 197
Bsp1286I GDGCHC 1 cut(s) 196
BspCNI CTCAG 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 195
BspT107I GGYRCC 1 cut(s) 193
BssECI CCNNGG 3 cut(s) 96, 197, 198
BssNI GRCGYC 2 cut(s) 117, 129
Bst2UI CCWGG 1 cut(s) 199
Bst4CI ACNGT 1 cut(s) 33
BstACI GRCGYC 2 cut(s) 117, 129
BstDEI CTNAG 1 cut(s) 249
BstDSI CCRYGG 1 cut(s) 96
BstMAI GTCTC 1 cut(s) 197
BstNI CCWGG 1 cut(s) 199
BstSCI CCNGG 1 cut(s) 197
BstSLI GKGCMC 1 cut(s) 196
BtgI CCRYGG 1 cut(s) 96
CseI GACGC 2 cut(s) 118, 125
CviAII CATG 1 cut(s) 25
CviJI RGCY 4 cut(s) 56, 101, 137, 177
CviKI_1 RGCY 4 cut(s) 56, 101, 137, 177
DdeI CTNAG 1 cut(s) 249
EcoRII CCWGG 1 cut(s) 197
FaeI CATG 1 cut(s) 28
FaiI YATR 1 cut(s) 26
FatI CATG 1 cut(s) 24
HgaI GACGC 2 cut(s) 118, 125
Hin1I GRCGYC 2 cut(s) 117, 129
Hin1II CATG 1 cut(s) 28
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 1 cut(s) 234
Hpy99I CGWCG 8 cut(s) 10, 37, 69, 87, 119, 134, 148, 166
HpyCH4III ACNGT 1 cut(s) 33
HpyCH4V TGCA 1 cut(s) 231
HpyF3I CTNAG 1 cut(s) 249
Hsp92I GRCGYC 2 cut(s) 117, 129
Hsp92II CATG 1 cut(s) 28
LpnPI CCDG 3 cut(s) 175, 184, 211
MhlI GDGCHC 1 cut(s) 196
MnlI CCTC 1 cut(s) 253
MspR9I CCNGG 1 cut(s) 199
MvaI CCWGG 1 cut(s) 199
NlaIII CATG 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 195
PasI CCCWGGG 1 cut(s) 198
PfeI GAWTC 1 cut(s) 234
Psp6I CCWGG 1 cut(s) 197
PspGI CCWGG 1 cut(s) 197
PspN4I GGNNCC 1 cut(s) 195
ScrFI CCNGG 1 cut(s) 199
SduI GDGCHC 1 cut(s) 196
SetI ASST 3 cut(s) 58, 139, 179
SgeI CNNG 7 cut(s) 21, 37, 109, 202, 210, 211, 231
StyD4I CCNGG 1 cut(s) 197
TaaI ACNGT 1 cut(s) 33
TaqI TCGA 1 cut(s) 132
TfiI GAWTC 1 cut(s) 234
TspDTI ATGAA 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.