Rroxscaffold_4G00330820

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
64583101 .. 64590758
7658 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00330820.1

Sequence Viewer

Length: 246 bp
ATGGCTGCAGCTTTGTCAAAACTGGTGTGCTGTAGTTGTTGTAAAGGAATGGTGGCTGCAACCTTGTCAAAATTGGTGGATACAAAGCTTCAGCTTTTCAAGAGTATTGTGCTGCAGCTGCAGGCAAAGTTTGGTGTCTTGCAACTTTGCCAAGTTAGGTGTGCCACTTCAGTTAAAGAGTATCAGATTTTCGAGCTGCCTGACCTTTCTGTACTAATTCGGCCATCACTTTTTGTAGAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.91

Weight (kDa)

9.04

Isoelectric Point (pI)

24.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 221
AcuI CTGAAG 2 cut(s) 74, 153
AfaI GTAC 1 cut(s) 213
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 5 cut(s) 11, 88, 94, 118, 196
AluI AGCT 5 cut(s) 11, 88, 94, 118, 196
AoxI GGCC 1 cut(s) 221
ApeKI GCWGC 7 cut(s) 5, 8, 56, 112, 115, 118, 196
BbvI GCAGC 6 cut(s) 20, 43, 99, 105, 127, 183
BccI CCATC 1 cut(s) 232
BciVI GTATCC 1 cut(s) 73
BfmI CTRYAG 4 cut(s) 6, 31, 113, 119
BfuI GTATCC 1 cut(s) 73
BisI GCNGC 7 cut(s) 6, 9, 57, 113, 116, 119, 197
BlsI GCNGC 7 cut(s) 7, 10, 58, 114, 117, 120, 198
Bse1I ACTGG 1 cut(s) 27
BseNI ACTGG 1 cut(s) 27
BseXI GCAGC 6 cut(s) 20, 43, 99, 105, 127, 183
BshFI GGCC 1 cut(s) 223
BsnI GGCC 1 cut(s) 223
BspANI GGCC 1 cut(s) 223
BspMAI CTGCAG 3 cut(s) 10, 117, 123
BsrI ACTGG 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 123
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstSFI CTRYAG 4 cut(s) 6, 31, 113, 119
BstV1I GCAGC 6 cut(s) 20, 43, 99, 105, 127, 183
BsuI GTATCC 1 cut(s) 73
BsuRI GGCC 1 cut(s) 223
Cac8I GCNNGC 1 cut(s) 123
Csp6I GTAC 1 cut(s) 212
CspCI CAANNNNNGTGG 2 cut(s) 57, 92
CviJI RGCY 8 cut(s) 5, 11, 56, 88, 94, 118, 196, 223
CviKI_1 RGCY 8 cut(s) 5, 11, 56, 88, 94, 118, 196, 223
CviQI GTAC 1 cut(s) 212
EaeI YGGCCR 1 cut(s) 221
Eco57I CTGAAG 2 cut(s) 74, 153
Fnu4HI GCNGC 7 cut(s) 6, 9, 57, 113, 116, 119, 197
Fsp4HI GCNGC 7 cut(s) 6, 9, 57, 113, 116, 119, 197
GluI GCNGC 7 cut(s) 6, 9, 57, 113, 116, 119, 197
HaeIII GGCC 1 cut(s) 223
HindIII AAGCTT 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 100
HpyCH4V TGCA 5 cut(s) 8, 59, 115, 121, 142
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
LpnPI CCDG 3 cut(s) 8, 107, 213
Lsp1109I GCAGC 6 cut(s) 20, 43, 99, 105, 127, 183
MluCI AATT 2 cut(s) 71, 216
MseI TTAA 1 cut(s) 174
MspA1I CMGCKG 1 cut(s) 118
MwoI GCNNNNNNNGC 1 cut(s) 118
PkrI GCNGC 7 cut(s) 7, 10, 58, 114, 117, 120, 198
PstI CTGCAG 3 cut(s) 10, 117, 123
PvuII CAGCTG 1 cut(s) 118
RsaI GTAC 1 cut(s) 213
RsaNI GTAC 1 cut(s) 212
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 7 cut(s) 6, 9, 57, 113, 116, 119, 197
SetI ASST 8 cut(s) 13, 65, 90, 96, 120, 161, 198, 207
SfcI CTRYAG 4 cut(s) 6, 31, 113, 119
SgeI CNNG 8 cut(s) 35, 76, 112, 134, 151, 164, 205, 212
Sse9I AATT 2 cut(s) 71, 216
TaqI TCGA 1 cut(s) 192
TasI AATT 2 cut(s) 71, 216
TatI WGTACW 1 cut(s) 211
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 7 cut(s) 5, 8, 56, 112, 115, 118, 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.