Rroxscaffold_3G00272550

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0012121
Physical Location & Seq
Reverse (-)
64637936 .. 64638983
1048 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00272550.1

Sequence Viewer

Length: 378 bp
ATGAGTTCTTCCCCAGCTGCCAGCAAACCAACCAAACAAACAAGTGACAACATCAGACCACCCAAACTCAAGTTCCAAGAACATGGATCTGCCTACCACCGTGCTAAACTCCTCCGTCCCTACTGTCCTCTGTCCTCTAAAACCCAGATTCCGACGAGCCTTACCAACACGCCTCTATCTGCCCAACACACCTGGATCTGCCATAACCTAGATCGACAATCAAGTCCCTCGCCGATAACAAGCCATAAAACGCCTGCAACATCACACCAAGAATTGAGGGCCGCCATGTATCCACCAGAATCCTCTACACCGTTGTGCTCGATTCCAAGGTTTGAAGAATCCACAGCAGCAAAATACAAAAACCAAAACCAAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.9

Weight (kDa)

9.72

Isoelectric Point (pI)

66.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 222
AciI CCGC 1 cut(s) 282
AclWI GGATC 2 cut(s) 94, 203
AcsI RAATTY 1 cut(s) 372
AgsI TTSAA 1 cut(s) 335
AjnI CCWGG 1 cut(s) 191
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
AleI CACNNNNGTG 1 cut(s) 313
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
Alw21I GWGCWC 1 cut(s) 320
AlwI GGATC 2 cut(s) 94, 203
AoxI GGCC 1 cut(s) 279
ApeKI GCWGC 2 cut(s) 17, 347
ApoI RAATTY 1 cut(s) 372
AspS9I GGNCC 1 cut(s) 279
Bbv12I GWGCWC 1 cut(s) 320
BbvI GCAGC 2 cut(s) 4, 359
BciT130I CCWGG 1 cut(s) 193
BciVI GTATCC 1 cut(s) 300
BfaI CTAG 1 cut(s) 209
BfuI GTATCC 1 cut(s) 300
BisI GCNGC 3 cut(s) 18, 282, 348
BlsI GCNGC 3 cut(s) 19, 283, 349
Bme1390I CCNGG 1 cut(s) 193
BmgT120I GGNCC 1 cut(s) 279
BmrFI CCNGG 1 cut(s) 193
BpuEI CTTGAG 1 cut(s) 53
BsaJI CCNNGG 1 cut(s) 326
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 326
BseRI GAGGAG 1 cut(s) 101
BseXI GCAGC 2 cut(s) 4, 359
BseYI CCCAGC 1 cut(s) 13
BshFI GGCC 1 cut(s) 281
BsiHKAI GWGCWC 1 cut(s) 320
BslFI GGGAC 2 cut(s) 102, 210
BsmFI GGGAC 2 cut(s) 102, 210
BsnI GGCC 1 cut(s) 281
Bsp1286I GDGCHC 1 cut(s) 320
Bsp143I GATC 3 cut(s) 86, 195, 211
BspACI CCGC 1 cut(s) 282
BspANI GGCC 1 cut(s) 281
BspPI GGATC 2 cut(s) 94, 203
BssECI CCNNGG 1 cut(s) 326
BssMI GATC 3 cut(s) 86, 195, 211
BssT1I CCWWGG 1 cut(s) 326
Bst2UI CCWGG 1 cut(s) 193
Bst4CI ACNGT 3 cut(s) 101, 125, 312
BstC8I GCNNGC 2 cut(s) 22, 255
BstKTI GATC 3 cut(s) 89, 198, 214
BstMBI GATC 3 cut(s) 86, 195, 211
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BstV1I GCAGC 2 cut(s) 4, 359
BstX2I RGATCY 2 cut(s) 86, 195
BstXI CCANNNNNNTGG 1 cut(s) 83
BstYI RGATCY 2 cut(s) 86, 195
BsuI GTATCC 1 cut(s) 300
BsuRI GGCC 1 cut(s) 281
Cac8I GCNNGC 2 cut(s) 22, 255
Cfr13I GGNCC 1 cut(s) 279
CviAII CATG 2 cut(s) 83, 286
CviJI RGCY 4 cut(s) 17, 159, 243, 281
CviKI_1 RGCY 4 cut(s) 17, 159, 243, 281
DpnI GATC 3 cut(s) 88, 197, 213
DpnII GATC 3 cut(s) 86, 195, 211
DrdI GACNNNNNNGTC 1 cut(s) 222
DseDI GACNNNNNNGTC 1 cut(s) 222
Eco130I CCWWGG 1 cut(s) 326
EcoRII CCWGG 1 cut(s) 191
EcoT14I CCWWGG 1 cut(s) 326
ErhI CCWWGG 1 cut(s) 326
FaeI CATG 2 cut(s) 86, 289
FaiI YATR 4 cut(s) 84, 204, 246, 287
FaqI GGGAC 2 cut(s) 102, 210
FatI CATG 2 cut(s) 82, 285
Fnu4HI GCNGC 3 cut(s) 18, 282, 348
Fsp4HI GCNGC 3 cut(s) 18, 282, 348
FspBI CTAG 1 cut(s) 209
GluI GCNGC 3 cut(s) 18, 282, 348
GsaI CCCAGC 1 cut(s) 17
HaeIII GGCC 1 cut(s) 281
Hin1II CATG 2 cut(s) 86, 289
HinfI GANTC 4 cut(s) 148, 299, 322, 338
Hpy188I TCNGA 2 cut(s) 56, 153
Hpy99I CGWCG 1 cut(s) 157
HpyCH4III ACNGT 3 cut(s) 101, 125, 312
HpyCH4V TGCA 1 cut(s) 257
Hsp92II CATG 2 cut(s) 86, 289
Kzo9I GATC 3 cut(s) 86, 195, 211
LpnPI CCDG 7 cut(s) 27, 34, 158, 178, 205, 267, 309
Lsp1109I GCAGC 2 cut(s) 4, 359
MaeI CTAG 1 cut(s) 209
MaeIII GTNAC 1 cut(s) 44
MalI GATC 3 cut(s) 88, 197, 213
MboI GATC 3 cut(s) 86, 195, 211
MboII GAAGA 1 cut(s) 347
MflI RGATCY 2 cut(s) 86, 195
MhlI GDGCHC 1 cut(s) 320
MluCI AATT 2 cut(s) 272, 372
MmeI TCCRAC 1 cut(s) 176
MnlI CCTC 7 cut(s) 122, 138, 145, 183, 238, 270, 313
MslI CAYNNNNRTG 1 cut(s) 313
MspA1I CMGCKG 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 193
MvaI CCWGG 1 cut(s) 193
NdeII GATC 3 cut(s) 86, 195, 211
NlaIII CATG 2 cut(s) 86, 289
NmuCI GTSAC 1 cut(s) 44
OliI CACNNNNGTG 1 cut(s) 313
PfeI GAWTC 4 cut(s) 148, 299, 322, 338
PkrI GCNGC 3 cut(s) 19, 283, 349
Psp6I CCWGG 1 cut(s) 191
PspFI CCCAGC 1 cut(s) 13
PspGI CCWGG 1 cut(s) 191
PspPI GGNCC 1 cut(s) 279
PsuI RGATCY 2 cut(s) 86, 195
PvuII CAGCTG 1 cut(s) 17
RseI CAYNNNNRTG 1 cut(s) 313
SatI GCNGC 3 cut(s) 18, 282, 348
Sau3AI GATC 3 cut(s) 86, 195, 211
Sau96I GGNCC 1 cut(s) 279
ScrFI CCNGG 1 cut(s) 193
SduI GDGCHC 1 cut(s) 320
SetI ASST 4 cut(s) 19, 194, 210, 332
SmiMI CAYNNNNRTG 1 cut(s) 313
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
Sse9I AATT 2 cut(s) 272, 372
SsiI CCGC 1 cut(s) 282
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 1 cut(s) 191
StyI CCWWGG 1 cut(s) 326
TaaI ACNGT 3 cut(s) 101, 125, 312
TaqI TCGA 2 cut(s) 214, 320
TasI AATT 2 cut(s) 272, 372
TauI GCSGC 1 cut(s) 284
TfiI GAWTC 4 cut(s) 148, 299, 322, 338
TseFI GTSAC 1 cut(s) 44
TseI GCWGC 2 cut(s) 17, 347
Tsp45I GTSAC 1 cut(s) 44
TspGWI ACGGA 1 cut(s) 104
XapI RAATTY 1 cut(s) 372
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.