Rroxscaffold_4G00278940

Tripeptidyl-peptidase 2-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
1874856 .. 1878163
3308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00278940.1

Sequence Viewer

Length: 336 bp
ATGTCTCATTTTAAATGTCTTAGAGCGTACCTCAAAAAAGAAGAAATAAGGAAAAAATGGGATGAACAAAACCAAGAAATTGCAAAGGCTGTTATGCATCTTCATGAATTTGACCAGAAACACAGTAGAGTGGAGGATGCTAACTTGAAAAGGGCTAGGGAGGACCTGCAAAACAGAGTTGATTACCTAAAAAAGCAAGCTGAGCTATATGATGAAAAAGGGCCTGTCATAGATGCTGTTGTATGGCATGATGGAGAAGTATGGAGAGTTTCCATTGACACAGAGACTGTTGAGGATGACCCTGATTGTGGAAAACTCGCTGACTTTGTGCCCTAA

Protein Analysis

111

Amino Acids

13.17

Weight (kDa)

5.35

Isoelectric Point (pI)

44.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 174
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 308
AgsI TTSAA 1 cut(s) 148
AluBI AGCT 2 cut(s) 200, 205
AluI AGCT 2 cut(s) 200, 205
Alw26I GTCTC 2 cut(s) 9, 278
AlwNI CAGNNNCTG 1 cut(s) 287
AoxI GGCC 1 cut(s) 221
ApoI RAATTY 1 cut(s) 107
AspS9I GGNCC 2 cut(s) 163, 221
AvaII GGWCC 1 cut(s) 163
BaeGI GKGCMC 1 cut(s) 333
BccI CCATC 1 cut(s) 245
BcoDI GTCTC 2 cut(s) 9, 278
BfaI CTAG 1 cut(s) 156
BfuAI ACCTGC 1 cut(s) 174
BlpI GCTNAGC 1 cut(s) 201
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 2 cut(s) 163, 221
BmsI GCATC 3 cut(s) 106, 127, 223
BplI GAGNNNNNCTC 2 cut(s) 15, 47
Bpu1102I GCTNAGC 1 cut(s) 201
Bsc4I CCNNNNNNNGG 1 cut(s) 308
BseGI GGATG 3 cut(s) 67, 142, 301
BseLI CCNNNNNNNGG 1 cut(s) 308
BseMII CTCAG 1 cut(s) 192
BseSI GKGCMC 1 cut(s) 333
BshFI GGCC 1 cut(s) 223
BslI CCNNNNNNNGG 1 cut(s) 308
BsmAI GTCTC 2 cut(s) 9, 278
BsnI GGCC 1 cut(s) 223
Bsp1286I GDGCHC 1 cut(s) 333
Bsp1720I GCTNAGC 1 cut(s) 201
BspANI GGCC 1 cut(s) 223
BspCNI CTCAG 1 cut(s) 193
BspHI TCATGA 1 cut(s) 103
BspMI ACCTGC 1 cut(s) 174
Bst4CI ACNGT 2 cut(s) 125, 289
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 2 cut(s) 20, 201
BstF5I GGATG 3 cut(s) 67, 142, 301
BstMAI GTCTC 2 cut(s) 9, 278
BstMWI GCNNNNNNNGC 1 cut(s) 202
BstSLI GKGCMC 1 cut(s) 333
BsuRI GGCC 1 cut(s) 223
BtsCI GGATG 3 cut(s) 67, 142, 301
BveI ACCTGC 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 198
CaiI CAGNNNCTG 1 cut(s) 287
CciI TCATGA 1 cut(s) 103
Cfr13I GGNCC 2 cut(s) 163, 221
Csp6I GTAC 1 cut(s) 28
CviAII CATG 2 cut(s) 104, 248
CviJI RGCY 5 cut(s) 89, 155, 200, 205, 223
CviKI_1 RGCY 5 cut(s) 89, 155, 200, 205, 223
CviQI GTAC 1 cut(s) 28
DdeI CTNAG 2 cut(s) 20, 201
DraI TTTAAA 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 163
EcoO109I RGGNCCY 2 cut(s) 163, 221
EcoT22I ATGCAT 1 cut(s) 99
FaeI CATG 2 cut(s) 107, 251
FaiI YATR 8 cut(s) 95, 105, 208, 210, 230, 244, 249, 262
FatI CATG 2 cut(s) 103, 247
FokI GGATG 3 cut(s) 74, 149, 308
FspBI CTAG 1 cut(s) 156
HaeIII GGCC 1 cut(s) 223
Hin1II CATG 2 cut(s) 107, 251
Hpy188III TCNNGA 1 cut(s) 104
HpyCH4III ACNGT 2 cut(s) 125, 289
HpyCH4V TGCA 3 cut(s) 83, 97, 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 202
HpyF3I CTNAG 2 cut(s) 20, 201
Hsp92II CATG 2 cut(s) 107, 251
LpnPI CCDG 4 cut(s) 128, 179, 237, 315
LweI GCATC 3 cut(s) 106, 127, 223
MaeI CTAG 1 cut(s) 156
MboII GAAGA 2 cut(s) 53, 92
MhlI GDGCHC 1 cut(s) 333
MluCI AATT 2 cut(s) 78, 107
MnlI CCTC 4 cut(s) 41, 127, 154, 286
Mph1103I ATGCAT 1 cut(s) 99
MseI TTAA 1 cut(s) 12
MslI CAYNNNNRTG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 202
NlaIII CATG 2 cut(s) 107, 251
NsiI ATGCAT 1 cut(s) 99
PagI TCATGA 1 cut(s) 103
PpuMI RGGWCCY 1 cut(s) 163
Psp5II RGGWCCY 1 cut(s) 163
PspPI GGNCC 2 cut(s) 163, 221
PspPPI RGGWCCY 1 cut(s) 163
PstNI CAGNNNCTG 1 cut(s) 287
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 102
SaqAI TTAA 1 cut(s) 12
Sau96I GGNCC 2 cut(s) 163, 221
SduI GDGCHC 1 cut(s) 333
SetI ASST 5 cut(s) 33, 168, 189, 202, 207
SfaNI GCATC 3 cut(s) 106, 127, 223
SinI GGWCC 1 cut(s) 163
SmiMI CAYNNNNRTG 1 cut(s) 102
Sse9I AATT 2 cut(s) 78, 107
SspMI CTAG 1 cut(s) 156
TaaI ACNGT 2 cut(s) 125, 289
TasI AATT 2 cut(s) 78, 107
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 4 cut(s) 78, 92, 120, 228
VpaK11BI GGWCC 1 cut(s) 163
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.