Rroxscaffold_4G00299000
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
18910207 .. 18913357
3151 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00299000.1

Sequence Viewer

Length: 318 bp
ATGGGAACATTTGGCTATGTTGCACCAGAGTATGCTTGCACCGGAATGTTGAATGAGAAGAGTGATGTATATAGCTTTGGAATACTTATAATGGAGATAATATCTGGGAGAAACCCTGTTGATTATGGTCGGCCAAAAGGAGAGGTGAATCTAGTTGAATGGTTAAAAAACATGGTTGGAGACCGGAAAGCTGAGGAAGTAGTTGATCCTAAGTTGCCTGAGATGCCTGCTTCAAAAGCACTTAAACGTGCTCTGCTGGTTGCTCTTCGATGTGTTGATCCTGATGCCACAAAAAAGGCCAAAAAATGGGACATGTGA

Protein Analysis

105

Amino Acids

11.71

Weight (kDa)

7.7

Isoelectric Point (pI)

33.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 2 - 53 1e-06 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 6 - 45 1.7e-07 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 89
AccB7I CCANNNNNTGG 1 cut(s) 306
AclWI GGATC 2 cut(s) 200, 272
AcoI YGGCCR 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 306
AflIII ACRYGT 1 cut(s) 312
AgsI TTSAA 3 cut(s) 52, 158, 234
AluBI AGCT 2 cut(s) 75, 191
AluI AGCT 2 cut(s) 75, 191
Alw21I GWGCWC 1 cut(s) 253
Alw26I GTCTC 1 cut(s) 174
AlwI GGATC 2 cut(s) 200, 272
AoxI GGCC 2 cut(s) 131, 297
AsuHPI GGTGA 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 253
BbvCI CCTCAGC 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 174
BfaI CTAG 1 cut(s) 152
BmsI GCATC 2 cut(s) 213, 274
Bpu10I CCTNAGC 1 cut(s) 192
BsaI GGTCTC 1 cut(s) 174
BsaWI WCCGGW 2 cut(s) 41, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 306
BseLI CCNNNNNNNGG 1 cut(s) 306
BseMII CTCAG 2 cut(s) 183, 210
BshFI GGCC 2 cut(s) 133, 299
BsiHKAI GWGCWC 1 cut(s) 253
BsiSI CCGG 2 cut(s) 42, 184
BslI CCNNNNNNNGG 1 cut(s) 306
BsmAI GTCTC 1 cut(s) 174
BsnI GGCC 2 cut(s) 133, 299
Bso31I GGTCTC 1 cut(s) 174
Bsp1286I GDGCHC 1 cut(s) 253
Bsp143I GATC 2 cut(s) 205, 277
BspANI GGCC 2 cut(s) 133, 299
BspCNI CTCAG 2 cut(s) 184, 211
BspPI GGATC 2 cut(s) 200, 272
BspQI GCTCTTC 1 cut(s) 270
BspTNI GGTCTC 1 cut(s) 174
BssMI GATC 2 cut(s) 205, 277
Bst6I CTCTTC 2 cut(s) 53, 270
BstC8I GCNNGC 2 cut(s) 37, 228
BstDEI CTNAG 3 cut(s) 192, 210, 219
BstKTI GATC 2 cut(s) 208, 280
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 2 cut(s) 205, 277
BstMWI GCNNNNNNNGC 2 cut(s) 223, 236
BstNSI RCATGY 1 cut(s) 316
BsuRI GGCC 2 cut(s) 133, 299
Cac8I GCNNGC 2 cut(s) 37, 228
CviAII CATG 2 cut(s) 172, 313
CviJI RGCY 5 cut(s) 15, 75, 133, 191, 299
CviKI_1 RGCY 5 cut(s) 15, 75, 133, 191, 299
DdeI CTNAG 3 cut(s) 192, 210, 219
DpnI GATC 2 cut(s) 207, 279
DpnII GATC 2 cut(s) 205, 277
EaeI YGGCCR 1 cut(s) 131
Eam1104I CTCTTC 2 cut(s) 53, 270
EarI CTCTTC 2 cut(s) 53, 270
Eco31I GGTCTC 1 cut(s) 174
FaeI CATG 2 cut(s) 175, 316
FaiI YATR 8 cut(s) 18, 33, 70, 72, 89, 126, 173, 314
FatI CATG 2 cut(s) 171, 312
FspBI CTAG 1 cut(s) 152
HaeIII GGCC 2 cut(s) 133, 299
HapII CCGG 2 cut(s) 42, 184
Hin1II CATG 2 cut(s) 175, 316
HinfI GANTC 1 cut(s) 148
HpaII CCGG 2 cut(s) 42, 184
HphI GGTGA 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 281
HpyCH4IV ACGT 1 cut(s) 247
HpyCH4V TGCA 2 cut(s) 23, 39
HpyF10VI GCNNNNNNNGC 2 cut(s) 223, 236
HpyF3I CTNAG 3 cut(s) 192, 210, 219
HpySE526I ACGT 1 cut(s) 247
Hsp92II CATG 2 cut(s) 175, 316
Kzo9I GATC 2 cut(s) 205, 277
LguI GCTCTTC 1 cut(s) 270
LpnPI CCDG 9 cut(s) 39, 55, 90, 129, 197, 231, 240, 242, 294
LweI GCATC 2 cut(s) 213, 274
MaeI CTAG 1 cut(s) 152
MaeII ACGT 1 cut(s) 247
MalI GATC 2 cut(s) 207, 279
MboI GATC 2 cut(s) 205, 277
MboII GAAGA 2 cut(s) 70, 257
MhlI GDGCHC 1 cut(s) 253
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 2 cut(s) 136, 187
MseI TTAA 2 cut(s) 164, 243
MslI CAYNNNNRTG 1 cut(s) 44
MspI CCGG 2 cut(s) 42, 184
MwoI GCNNNNNNNGC 2 cut(s) 223, 236
NdeII GATC 2 cut(s) 205, 277
NlaIII CATG 2 cut(s) 175, 316
NspI RCATGY 1 cut(s) 316
PciI ACATGT 1 cut(s) 312
PciSI GCTCTTC 1 cut(s) 270
PfeI GAWTC 1 cut(s) 148
PflMI CCANNNNNTGG 1 cut(s) 306
PscI ACATGT 1 cut(s) 312
PsiI TTATAA 1 cut(s) 89
RseI CAYNNNNRTG 1 cut(s) 44
SapI GCTCTTC 1 cut(s) 270
SaqAI TTAA 2 cut(s) 164, 243
Sau3AI GATC 2 cut(s) 205, 277
SduI GDGCHC 1 cut(s) 253
SetI ASST 4 cut(s) 77, 147, 193, 250
SfaNI GCATC 2 cut(s) 213, 274
SmiMI CAYNNNNRTG 1 cut(s) 44
SspMI CTAG 1 cut(s) 152
TaiI ACGT 1 cut(s) 250
TaqI TCGA 1 cut(s) 268
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 2 cut(s) 164, 243
Tru9I TTAA 2 cut(s) 164, 243
Van91I CCANNNNNTGG 1 cut(s) 306
XceI RCATGY 1 cut(s) 316
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.