Rroxscaffold_5G00342800

Divergent PAP2 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
11906524 .. 11909020
2497 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00342800.1

Sequence Viewer

Length: 294 bp
ATGATAGCACAAAATGGAGGCAGAATGAAAAGTTACGACGACATCCATATCTTGCGATTTCTTCTGGTTCCATCGCTACAGGTTTTGGTTGCAGCTGGTGTTTGTGCGGCATTTGGGCAACTGTCCAAGCCTTTAACTGATGTAATTATGTATGGCAAAGAGTTTGATTTCAAGGCAACTGCTGGCGGCTTCCCTTCCACGCATTCCTCTGAGCAGAGGACCTCAATCAGGATTCGCTCTGAGGATCAAAGGTTGCAGGATGAGTACATGACACACCCTCCAAGCTCGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.79

Weight (kDa)

7.92

Isoelectric Point (pI)

62.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 107, 186
AclWI GGATC 1 cut(s) 252
AfaI GTAC 1 cut(s) 266
AfiI CCNNNNNNNGG 1 cut(s) 228
AgsI TTSAA 1 cut(s) 172
AluBI AGCT 2 cut(s) 95, 285
AluI AGCT 2 cut(s) 95, 285
AlwI GGATC 1 cut(s) 252
ApeKI GCWGC 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 219
AvaII GGWCC 1 cut(s) 219
BbvI GCAGC 1 cut(s) 104
BccI CCATC 1 cut(s) 79
BfmI CTRYAG 1 cut(s) 77
BisI GCNGC 3 cut(s) 93, 108, 187
BlsI GCNGC 3 cut(s) 94, 109, 188
Bme18I GGWCC 1 cut(s) 219
BmgT120I GGNCC 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 262, 292
Bsc4I CCNNNNNNNGG 1 cut(s) 228
BseGI GGATG 2 cut(s) 42, 265
BseLI CCNNNNNNNGG 1 cut(s) 228
BseMII CTCAG 2 cut(s) 201, 231
BseXI GCAGC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 228
BsmI GAATGC 1 cut(s) 202
Bsp143I GATC 1 cut(s) 244
BspACI CCGC 2 cut(s) 107, 186
BspCNI CTCAG 2 cut(s) 202, 232
BspLI GGNNCC 1 cut(s) 69
BspPI GGATC 1 cut(s) 252
BssMI GATC 1 cut(s) 244
Bst4CI ACNGT 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 184
BstDEI CTNAG 2 cut(s) 210, 240
BstENI CCTNNNNNAGG 1 cut(s) 226
BstF5I GGATG 2 cut(s) 42, 265
BstKTI GATC 1 cut(s) 247
BstMBI GATC 1 cut(s) 244
BstSFI CTRYAG 1 cut(s) 77
BstV1I GCAGC 1 cut(s) 104
BtgZI GCGATG 1 cut(s) 57
BtsCI GGATG 2 cut(s) 42, 265
Cac8I GCNNGC 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 219
Csp6I GTAC 1 cut(s) 265
CviAII CATG 1 cut(s) 268
CviJI RGCY 4 cut(s) 95, 130, 189, 285
CviKI_1 RGCY 4 cut(s) 95, 130, 189, 285
CviQI GTAC 1 cut(s) 265
DdeI CTNAG 2 cut(s) 210, 240
DpnI GATC 1 cut(s) 246
DpnII GATC 1 cut(s) 244
Eco47I GGWCC 1 cut(s) 219
EcoNI CCTNNNNNAGG 1 cut(s) 226
EcoO109I RGGNCCY 1 cut(s) 219
FaeI CATG 1 cut(s) 271
FaiI YATR 4 cut(s) 48, 149, 153, 269
FatI CATG 1 cut(s) 267
Fnu4HI GCNGC 3 cut(s) 93, 108, 187
FokI GGATG 2 cut(s) 29, 272
Fsp4HI GCNGC 3 cut(s) 93, 108, 187
GluI GCNGC 3 cut(s) 93, 108, 187
Hin1II CATG 1 cut(s) 271
HinfI GANTC 1 cut(s) 232
Hpy188I TCNGA 2 cut(s) 211, 241
Hpy188III TCNNGA 1 cut(s) 229
Hpy99I CGWCG 1 cut(s) 41
HpyAV CCTTC 1 cut(s) 204
HpyCH4III ACNGT 1 cut(s) 123
HpyCH4V TGCA 2 cut(s) 92, 256
HpyF3I CTNAG 2 cut(s) 210, 240
Hsp92II CATG 1 cut(s) 271
Kzo9I GATC 1 cut(s) 244
LpnPI CCDG 6 cut(s) 50, 65, 81, 168, 214, 242
Lsp1109I GCAGC 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 32
MalI GATC 1 cut(s) 246
MboI GATC 1 cut(s) 244
MboII GAAGA 1 cut(s) 53
MluCI AATT 1 cut(s) 144
MnlI CCTC 6 cut(s) 11, 210, 217, 232, 235, 288
MseI TTAA 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 95
Mva1269I GAATGC 1 cut(s) 202
NdeII GATC 1 cut(s) 244
NlaIII CATG 1 cut(s) 271
NlaIV GGNNCC 1 cut(s) 69
PctI GAATGC 1 cut(s) 202
PfeI GAWTC 1 cut(s) 232
PkrI GCNGC 3 cut(s) 94, 109, 188
PpuMI RGGWCCY 1 cut(s) 219
Psp5II RGGWCCY 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 219
PspPPI RGGWCCY 1 cut(s) 219
PvuII CAGCTG 1 cut(s) 95
RsaI GTAC 1 cut(s) 266
RsaNI GTAC 1 cut(s) 265
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 3 cut(s) 93, 108, 187
Sau3AI GATC 1 cut(s) 244
Sau96I GGNCC 1 cut(s) 219
SetI ASST 5 cut(s) 84, 97, 224, 254, 287
SfcI CTRYAG 1 cut(s) 77
SinI GGWCC 1 cut(s) 219
Sse9I AATT 1 cut(s) 144
SsiI CCGC 2 cut(s) 107, 186
TaaI ACNGT 1 cut(s) 123
TaqI TCGA 1 cut(s) 287
TasI AATT 1 cut(s) 144
TatI WGTACW 1 cut(s) 264
TauI GCSGC 2 cut(s) 110, 189
TfiI GAWTC 1 cut(s) 232
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TseI GCWGC 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 219
XagI CCTNNNNNAGG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.