Rroxscaffold_6G00405040

HUA2-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
27518496 .. 27519248
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00405040.1

Sequence Viewer

Length: 273 bp
ATGCAAAAAGCATGGGTAAAAAATAGAGGTAGAGAGAGCACCTGTCTGCTTCTGCTTCTCTGCTCCGCAAAAAGAGAGAGCAGAGGGAAACCGGAAATTCGAGGGGAGGAAGTAAGAAGGTCATCAAGGCCAACCAACAAGAATTGGTGGGGAGAATTTGGGTTGGGTGAGCTGCCAAGGGCTGGTAAGAGATGTAATCAAGGTTCAATGGATGATTTTCCTCAGAAAGATGAAGGTCATGCAAAAATTGAATCGAGCAATAAAGATGGATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.23

Weight (kDa)

9.6

Isoelectric Point (pI)

54.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AciI CCGC 1 cut(s) 66
AcsI RAATTY 2 cut(s) 96, 155
AfiI CCNNNNNNNGG 1 cut(s) 182
AgsI TTSAA 2 cut(s) 207, 251
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
Alw21I GWGCWC 1 cut(s) 41
AoxI GGCC 1 cut(s) 128
ApeKI GCWGC 1 cut(s) 172
ApoI RAATTY 2 cut(s) 96, 155
AsuHPI GGTGA 1 cut(s) 179
Bbv12I GWGCWC 1 cut(s) 41
BbvI GCAGC 1 cut(s) 159
BccI CCATC 1 cut(s) 260
BisI GCNGC 1 cut(s) 173
BlsI GCNGC 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 176
BsaWI WCCGGW 1 cut(s) 91
Bsc4I CCNNNNNNNGG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 176
BseGI GGATG 1 cut(s) 217
BseLI CCNNNNNNNGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 236
BseXI GCAGC 1 cut(s) 159
BshFI GGCC 1 cut(s) 130
BsiHKAI GWGCWC 1 cut(s) 41
BsiSI CCGG 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 182
BsnI GGCC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 41
BspACI CCGC 1 cut(s) 66
BspANI GGCC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 235
BssECI CCNNGG 1 cut(s) 176
BssT1I CCWWGG 1 cut(s) 176
BstDEI CTNAG 1 cut(s) 222
BstF5I GGATG 1 cut(s) 217
BstV1I GCAGC 1 cut(s) 159
BsuRI GGCC 1 cut(s) 130
BtsCI GGATG 1 cut(s) 217
CviAII CATG 2 cut(s) 12, 239
CviJI RGCY 3 cut(s) 130, 172, 182
CviKI_1 RGCY 3 cut(s) 130, 172, 182
DdeI CTNAG 1 cut(s) 222
Eco130I CCWWGG 1 cut(s) 176
EcoT14I CCWWGG 1 cut(s) 176
ErhI CCWWGG 1 cut(s) 176
FaeI CATG 2 cut(s) 15, 242
FaiI YATR 2 cut(s) 13, 240
FatI CATG 2 cut(s) 11, 238
Fnu4HI GCNGC 1 cut(s) 173
FokI GGATG 1 cut(s) 224
Fsp4HI GCNGC 1 cut(s) 173
GluI GCNGC 1 cut(s) 173
HaeIII GGCC 1 cut(s) 130
HapII CCGG 1 cut(s) 92
Hin1II CATG 2 cut(s) 15, 242
HinfI GANTC 1 cut(s) 251
HpaII CCGG 1 cut(s) 92
HphI GGTGA 1 cut(s) 179
Hpy188I TCNGA 1 cut(s) 225
HpyAV CCTTC 2 cut(s) 111, 227
HpyCH4V TGCA 2 cut(s) 4, 242
HpyF3I CTNAG 1 cut(s) 222
Hsp92II CATG 2 cut(s) 15, 242
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 3 cut(s) 55, 105, 168
Lsp1109I GCAGC 1 cut(s) 159
MhlI GDGCHC 1 cut(s) 41
MluCI AATT 4 cut(s) 96, 142, 155, 246
MnlI CCTC 5 cut(s) 20, 77, 95, 100, 231
MspI CCGG 1 cut(s) 92
NlaIII CATG 2 cut(s) 15, 242
PfeI GAWTC 1 cut(s) 251
PflMI CCANNNNNTGG 1 cut(s) 182
PkrI GCNGC 1 cut(s) 174
PsrI GAACNNNNNNTAC 2 cut(s) 187, 219
SatI GCNGC 1 cut(s) 173
SduI GDGCHC 1 cut(s) 41
SetI ASST 6 cut(s) 31, 44, 122, 174, 205, 238
Sse9I AATT 4 cut(s) 96, 142, 155, 246
SsiI CCGC 1 cut(s) 66
StyI CCWWGG 1 cut(s) 176
TaqI TCGA 2 cut(s) 100, 254
TasI AATT 4 cut(s) 96, 142, 155, 246
TfiI GAWTC 1 cut(s) 251
TseI GCWGC 1 cut(s) 172
TspDTI ATGAA 1 cut(s) 246
Van91I CCANNNNNTGG 1 cut(s) 182
XapI RAATTY 2 cut(s) 96, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.