Rroxscaffold_6G00408800

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
31300464 .. 31300724
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00408800.1

Sequence Viewer

Length: 225 bp
ATGTCTTCAAGTGAAGACAACATCAACAATGACGCCGTGGACTTGTTGAGAGAGATGTTGAATAAGGGGCACGGGTTCTTGAATTTGGAGAATTTGGACAAGGCCAATGAGCTTTTTGAGGTGTATGATGGGGTTGTCAATGCCACCTTTATGGATTGGTTCTTCAATAAGGGGAAAGAGAAGGAGGCAATGGATTCATACAGGTCTTGCTTGATAGGCGTTTAG

Protein Analysis

74

Amino Acids

8.45

Weight (kDa)

4.39

Isoelectric Point (pI)

50.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 82, 91
AcyI GRCGYC 1 cut(s) 33
AgsI TTSAA 4 cut(s) 9, 61, 82, 166
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
AoxI GGCC 1 cut(s) 102
ApoI RAATTY 2 cut(s) 82, 91
BaeGI GKGCMC 1 cut(s) 72
BbsI GAAGAC 1 cut(s) 21
BccI CCATC 1 cut(s) 122
BceAI ACGGC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 21
BsaHI GRCGYC 1 cut(s) 33
BsaJI CCNNGG 1 cut(s) 36
Bse3DI GCAATG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 195
BseSI GKGCMC 1 cut(s) 72
BshFI GGCC 1 cut(s) 104
BsnI GGCC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 72
BspANI GGCC 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 195
BssECI CCNNGG 1 cut(s) 36
BssNI GRCGYC 1 cut(s) 33
BstACI GRCGYC 1 cut(s) 33
BstDSI CCRYGG 1 cut(s) 36
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstSLI GKGCMC 1 cut(s) 72
BstV2I GAAGAC 1 cut(s) 21
BstXI CCANNNNNNTGG 1 cut(s) 151
BsuRI GGCC 1 cut(s) 104
BtgI CCRYGG 1 cut(s) 36
CseI GACGC 1 cut(s) 41
CviJI RGCY 2 cut(s) 104, 112
CviKI_1 RGCY 2 cut(s) 104, 112
FaiI YATR 3 cut(s) 126, 152, 199
HaeIII GGCC 1 cut(s) 104
HgaI GACGC 1 cut(s) 41
Hin1I GRCGYC 1 cut(s) 33
HinfI GANTC 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 79
Hpy8I GTNNAC 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
Hsp92I GRCGYC 1 cut(s) 33
LpnPI CCDG 1 cut(s) 187
MboII GAAGA 2 cut(s) 26, 154
MhlI GDGCHC 1 cut(s) 72
MluCI AATT 2 cut(s) 82, 91
MnlI CCTC 2 cut(s) 112, 178
MslI CAYNNNNRTG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 216
PfeI GAWTC 1 cut(s) 194
RseI CAYNNNNRTG 1 cut(s) 149
SduI GDGCHC 1 cut(s) 72
SetI ASST 4 cut(s) 114, 123, 149, 206
SgeI CNNG 9 cut(s) 21, 49, 55, 83, 85, 91, 112, 214, 219
SmiMI CAYNNNNRTG 1 cut(s) 149
Sse9I AATT 2 cut(s) 82, 91
TasI AATT 2 cut(s) 82, 91
TfiI GAWTC 1 cut(s) 194
TspDTI ATGAA 1 cut(s) 186
XapI RAATTY 2 cut(s) 82, 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.