Rroxscaffold_7G00200060

May act early in the ethylene signal transduction pathway, possibly as an ethylene receptor, or as a regulator of the pathway

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
47377306 .. 47378620
1315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00200060.1

Sequence Viewer

Length: 327 bp
ATGAAATTAAGAAGGCTTGAGCTTCAGCATTTGCAAAAAGATTGTCCAGATGATGCAAGGCAATATATGGATGTCCATGAACCCAATCAATCTTGCAGAAAGCATGACACTAGTTCTCGGGCTTCAAATCCTTCAATCTTTAGGGAGAGCTATGTATGTCGCTGGAAGCCTATTGGAGCAACCAGATTCCAACTCGAGTTCAGAGGACTCCGGGTTGTAGTAGCAGATGATGATAATGTAAACAGGACTACGACCACTAAATTGCTCCAGAAACTTGGCTGTCAAGTCGGTATTGTTTCTTTGAGGTTTGATTGCTTGCAGTTCTGA

Protein Analysis

108

Amino Acids

12.63

Weight (kDa)

9.17

Isoelectric Point (pI)

50.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 8
AgsI TTSAA 2 cut(s) 126, 135
AhlI ACTAGT 1 cut(s) 110
AluBI AGCT 2 cut(s) 22, 150
AluI AGCT 2 cut(s) 22, 150
Ama87I CYCGRG 2 cut(s) 117, 194
ArsI GACNNNNNNTTYG 2 cut(s) 28, 60
AsuC2I CCSGG 1 cut(s) 212
AvaI CYCGRG 2 cut(s) 117, 194
BcnI CCSGG 1 cut(s) 212
BcuI ACTAGT 1 cut(s) 110
BfaI CTAG 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 212
BmeT110I CYCGRG 2 cut(s) 117, 194
BmrFI CCNGG 1 cut(s) 212
BmsI GCATC 1 cut(s) 43
BpmI CTGGAG 1 cut(s) 251
BpuEI CTTGAG 1 cut(s) 38
BpuMI CCSGG 1 cut(s) 212
BseGI GGATG 1 cut(s) 76
BsiHKCI CYCGRG 2 cut(s) 117, 194
BsiSI CCGG 1 cut(s) 211
BsoBI CYCGRG 2 cut(s) 117, 194
BstC8I GCNNGC 1 cut(s) 317
BstF5I GGATG 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 210
BstXI CCANNNNNNTGG 1 cut(s) 275
BtsCI GGATG 1 cut(s) 76
Cac8I GCNNGC 1 cut(s) 317
CviAII CATG 2 cut(s) 77, 104
CviJI RGCY 6 cut(s) 16, 22, 122, 150, 169, 279
CviKI_1 RGCY 6 cut(s) 16, 22, 122, 150, 169, 279
Eco57I CTGAAG 1 cut(s) 8
Eco88I CYCGRG 2 cut(s) 117, 194
FaeI CATG 2 cut(s) 80, 107
FaiI YATR 6 cut(s) 66, 68, 78, 105, 153, 157
FatI CATG 2 cut(s) 76, 103
FokI GGATG 1 cut(s) 83
FspBI CTAG 1 cut(s) 111
GsuI CTGGAG 1 cut(s) 251
HapII CCGG 1 cut(s) 211
Hin1II CATG 2 cut(s) 80, 107
HinfI GANTC 2 cut(s) 186, 207
HpaII CCGG 1 cut(s) 211
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 203, 326
Hpy188III TCNNGA 2 cut(s) 47, 268
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 2 cut(s) 6, 141
HpyCH4V TGCA 4 cut(s) 34, 56, 96, 319
Hsp92II CATG 2 cut(s) 80, 107
LmnI GCTCC 2 cut(s) 176, 270
LpnPI CCDG 6 cut(s) 60, 148, 196, 224, 229, 281
LweI GCATC 1 cut(s) 43
MaeI CTAG 1 cut(s) 111
MluCI AATT 2 cut(s) 5, 260
MlyI GAGTC 1 cut(s) 201
MmeI TCCRAC 1 cut(s) 214
MnlI CCTC 2 cut(s) 197, 297
MseI TTAA 1 cut(s) 8
MspI CCGG 1 cut(s) 211
MspR9I CCNGG 1 cut(s) 212
NciI CCSGG 1 cut(s) 212
NlaIII CATG 2 cut(s) 80, 107
PaeR7I CTCGAG 1 cut(s) 194
PfeI GAWTC 1 cut(s) 186
PleI GAGTC 1 cut(s) 201
PpsI GAGTC 1 cut(s) 201
PspXI VCTCGAGB 1 cut(s) 194
SaqAI TTAA 1 cut(s) 8
SchI GAGTC 1 cut(s) 201
ScrFI CCNGG 1 cut(s) 212
SetI ASST 3 cut(s) 24, 152, 308
SfaNI GCATC 1 cut(s) 43
Sfr274I CTCGAG 1 cut(s) 194
SlaI CTCGAG 1 cut(s) 194
SmlI CTYRAG 2 cut(s) 17, 194
SmoI CTYRAG 2 cut(s) 17, 194
SpeI ACTAGT 1 cut(s) 110
Sse9I AATT 2 cut(s) 5, 260
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 210
TaqI TCGA 1 cut(s) 195
TasI AATT 2 cut(s) 5, 260
TfiI GAWTC 1 cut(s) 186
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TspDTI ATGAA 2 cut(s) 17, 93
XhoI CTCGAG 1 cut(s) 194
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.