Rorug02G0625400

May act early in the ethylene signal transduction pathway, possibly as an ethylene receptor, or as a regulator of the pathway

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0005257
Physical Location & Seq
Forward (+)
74171182 .. 74171487
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0625400.1

Sequence Viewer

Length: 306 bp
ATGTCAACTGTAATGCCAACGGGTTTCAGGTTCCATCCGAAGGATCACGAGTTGGTGAGCTATTACCTGTATAGCAAGGTGAATGGGGAAGAGTCGGTAATTCCACCACCAACCTATAGGATGCCAGAGGTCGACGTCTACGGCGAAGAGCCTTGGGAAATTTGGGAGAGATTCGGACAGCAAGACGAAGAACCGTTGTATTTCTTTGCAATTGCCAGGAAGTTAAACCCCAATGGTAAGCGGATTGATCGCAGGATAAACTCGAGATTGGGAACATGGAGCGAGGGAGAAAGATCTAAAGTCTAA

Protein Analysis

101

Amino Acids

11.98

Weight (kDa)

5.7

Isoelectric Point (pI)

49.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 6 - 98 5.8e-19 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 138
AccI GTMKAC 2 cut(s) 132, 138
AciI CCGC 1 cut(s) 241
AclWI GGATC 1 cut(s) 51
AcsI RAATTY 1 cut(s) 159
AcyI GRCGYC 1 cut(s) 135
AfiI CCNNNNNNNGG 1 cut(s) 40
AjnI CCWGG 1 cut(s) 215
AluBI AGCT 1 cut(s) 60
AluI AGCT 1 cut(s) 60
AlwI GGATC 1 cut(s) 51
Ama87I CYCGRG 1 cut(s) 262
ApoI RAATTY 1 cut(s) 159
AsuHPI GGTGA 2 cut(s) 67, 91
AvaI CYCGRG 1 cut(s) 262
BauI CACGAG 1 cut(s) 47
BccI CCATC 1 cut(s) 42
BceAI ACGGC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 217
BfmI CTRYAG 1 cut(s) 115
BglII AGATCT 1 cut(s) 293
Bme1390I CCNGG 1 cut(s) 217
BmeT110I CYCGRG 1 cut(s) 262
BmiI GGNNCC 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 217
BmsI GCATC 1 cut(s) 111
BsaHI GRCGYC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 217
BseDI CCNNGG 1 cut(s) 152
BseGI GGATG 2 cut(s) 34, 126
BseLI CCNNNNNNNGG 1 cut(s) 40
BsiHKCI CYCGRG 1 cut(s) 262
BslI CCNNNNNNNGG 1 cut(s) 40
BsoBI CYCGRG 1 cut(s) 262
Bsp143I GATC 3 cut(s) 43, 247, 293
BspACI CCGC 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 32
BspPI GGATC 1 cut(s) 51
BspQI GCTCTTC 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 152
BssMI GATC 3 cut(s) 43, 247, 293
BssNI GRCGYC 1 cut(s) 135
BssSI CACGAG 1 cut(s) 47
BssT1I CCWWGG 1 cut(s) 152
Bst2BI CACGAG 1 cut(s) 47
Bst2UI CCWGG 1 cut(s) 217
Bst4CI ACNGT 2 cut(s) 10, 195
Bst6I CTCTTC 2 cut(s) 84, 141
BstACI GRCGYC 1 cut(s) 135
BstF5I GGATG 2 cut(s) 34, 126
BstKTI GATC 3 cut(s) 46, 250, 296
BstMBI GATC 3 cut(s) 43, 247, 293
BstNI CCWGG 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 215
BstSFI CTRYAG 1 cut(s) 115
BstX2I RGATCY 1 cut(s) 293
BstYI RGATCY 1 cut(s) 293
BtsCI GGATG 2 cut(s) 34, 126
CviAII CATG 1 cut(s) 276
CviJI RGCY 2 cut(s) 60, 151
CviKI_1 RGCY 2 cut(s) 60, 151
DpnI GATC 3 cut(s) 45, 249, 295
DpnII GATC 3 cut(s) 43, 247, 293
Eam1104I CTCTTC 2 cut(s) 84, 141
EarI CTCTTC 2 cut(s) 84, 141
Eco130I CCWWGG 1 cut(s) 152
Eco88I CYCGRG 1 cut(s) 262
EcoRII CCWGG 1 cut(s) 215
EcoT14I CCWWGG 1 cut(s) 152
ErhI CCWWGG 1 cut(s) 152
FaeI CATG 1 cut(s) 279
FaiI YATR 3 cut(s) 72, 117, 277
FatI CATG 1 cut(s) 275
FblI GTMKAC 2 cut(s) 132, 138
FokI GGATG 2 cut(s) 21, 133
Hin1I GRCGYC 1 cut(s) 135
Hin1II CATG 1 cut(s) 279
HincII GTYRAC 2 cut(s) 6, 133
HindII GTYRAC 2 cut(s) 6, 133
HinfI GANTC 2 cut(s) 92, 171
HphI GGTGA 2 cut(s) 67, 91
Hpy166II GTNNAC 3 cut(s) 6, 133, 139
Hpy188I TCNGA 2 cut(s) 39, 176
Hpy188III TCNNGA 2 cut(s) 47, 264
Hpy8I GTNNAC 3 cut(s) 6, 133, 139
Hpy99I CGWCG 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 34
HpyCH4III ACNGT 2 cut(s) 10, 195
HpyCH4IV ACGT 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 209
HpySE526I ACGT 1 cut(s) 135
Hsp92I GRCGYC 1 cut(s) 135
Hsp92II CATG 1 cut(s) 279
Kzo9I GATC 3 cut(s) 43, 247, 293
LguI GCTCTTC 1 cut(s) 141
LmnI GCTCC 1 cut(s) 279
LpnPI CCDG 6 cut(s) 13, 80, 138, 202, 229, 238
LweI GCATC 1 cut(s) 111
MaeII ACGT 1 cut(s) 135
MalI GATC 3 cut(s) 45, 249, 295
MboI GATC 3 cut(s) 43, 247, 293
MboII GAAGA 3 cut(s) 101, 158, 200
MfeI CAATTG 1 cut(s) 210
MflI RGATCY 1 cut(s) 293
MluCI AATT 3 cut(s) 99, 159, 210
MlyI GAGTC 1 cut(s) 101
MnlI CCTC 2 cut(s) 121, 277
MseI TTAA 1 cut(s) 224
MspR9I CCNGG 1 cut(s) 217
MunI CAATTG 1 cut(s) 210
MvaI CCWGG 1 cut(s) 217
NdeII GATC 3 cut(s) 43, 247, 293
NlaIII CATG 1 cut(s) 279
NlaIV GGNNCC 1 cut(s) 32
PaeR7I CTCGAG 1 cut(s) 262
PciSI GCTCTTC 1 cut(s) 141
PcsI WCGNNNNNNNCGW 1 cut(s) 141
PfeI GAWTC 1 cut(s) 171
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 215
PspGI CCWGG 1 cut(s) 215
PspN4I GGNNCC 1 cut(s) 32
PsuI RGATCY 1 cut(s) 293
SalI GTCGAC 1 cut(s) 131
SapI GCTCTTC 1 cut(s) 141
SaqAI TTAA 1 cut(s) 224
Sau3AI GATC 3 cut(s) 43, 247, 293
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 217
SetI ASST 7 cut(s) 32, 62, 69, 81, 116, 132, 138
SfaNI GCATC 1 cut(s) 111
SfcI CTRYAG 1 cut(s) 115
Sfr274I CTCGAG 1 cut(s) 262
SlaI CTCGAG 1 cut(s) 262
SmlI CTYRAG 1 cut(s) 262
SmoI CTYRAG 1 cut(s) 262
Sse9I AATT 3 cut(s) 99, 159, 210
SsiI CCGC 1 cut(s) 241
StyD4I CCNGG 1 cut(s) 215
StyI CCWWGG 1 cut(s) 152
TaaI ACNGT 2 cut(s) 10, 195
TaiI ACGT 1 cut(s) 138
TaqI TCGA 2 cut(s) 132, 263
TasI AATT 3 cut(s) 99, 159, 210
TfiI GAWTC 1 cut(s) 171
Tru1I TTAA 1 cut(s) 224
Tru9I TTAA 1 cut(s) 224
XapI RAATTY 1 cut(s) 159
XhoI CTCGAG 1 cut(s) 262
XmiI GTMKAC 2 cut(s) 132, 138
ZraI GACGTC 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.