Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0002470

Physical Location & Seq

Genomic Coordinates Reverse (-)

57252226 .. 57257940

Gene Structure 5715 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00207380.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 501 bp

ATGGATGGGCTGAAAGGAAAATGCTTGAGACACCAAATATTTATACAAAAATTGAGCAAATTTTTTGTTGCCGATATCCTTACTGGTATTTGCGCCTTCACCTGTCCTCCTTCATTAGTAGTTGAAGATATGCTTGATGATACCATGGGTGTTGCTAGAGCTGGCAAGTTTATAACAACCACAATGCAAAAGGTCCAAAACTCGAGCTATATATTCAGAGAGGTCAGTCAAACTCCGTCCGTCTCGCCGAAGCCTAAACGATGTCGTACGACGACGTGGAGATCGAAGATATGGAGTGGAACGACGAGCTCCAGGCGTACACGTACCCGTGCCCATGCGGAGACTTGTTCCAGATCACCAAGGAAGACCTTAAATTGGGGGGAAGAGATCGCTCGGTGCCCTAGCTGTACTCTCTACATCACCGTCGTTTACAACGTCGAAGACTTCATCGATAAGAAGCCCTTCGAGCCCTCCCAGCAACAATCCCTCACCGTCGCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-CSL

Protein Analysis

166

Amino Acids

18.81

Weight (kDa)

9.61

Isoelectric Point (pI)

49.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002470)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G15910 AT2G15910
malus_domestica	MD10G1086600.v1.1
prunus_persica	Prupe.8G112600_v2.0.a1 Prupe.8G112600_v2.0.a1 Prupe.8G112600_v2.0.a1 Prupe.8G112600_v2.0.a1
pyrus_communis	pycom05g06430
rosa_chinensis	RchiOBHm_Chr4g0401321 RchiOBHm_Chr6g0259971 RchiOBHm_Chr6g0260171 RchiOBHm_Chr6g0260501 RchiOBHm_Chr6g0260511 RchiOBHm_Chr6g0260771
rosa_laevigata	RLG00000014486
rosa_multiflora	Rmu_sc0000588.1_g000023 Rmu_sc0000588.1_g000039 Rmu_sc0000588.1_g000061 Rmu_sc0010278.1_g000005 Rmu_sc0014629.1_g000012 Rmu_sc0036322.1_g000003
rosa_roxburghii	Rroxscaffold_7G00201470 Rroxscaffold_7G00207320 Rroxscaffold_7G00207380
rosa_rugosa	Rorug05G0591900 Rorug05G0592500
rosa_samantha	Rh6BG104900 Rh6BG106100 Rh6CG097600 Rh6CG099600 Rh6CG101300 Rh6CG102700 Rh6DG091400 Rh6DG092300 Rh6DG093300 Rh6DG094000
rosa_wichuraiana	Rw6G009430 Rw6G009460 Rw6G009490 Rw6G009860 Rw6G009880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	173
AccB1I	GGYRCC	1 cut(s)	396
AciI	CCGC	1 cut(s)	338
AcsI	RAATTY	1 cut(s)	59
AfaI	GTAC	4 cut(s)	268, 319, 325, 409
AfiI	CCNNNNNNNGG	1 cut(s)	375
AflIII	ACRYGT	1 cut(s)	320
AgsI	TTSAA	1 cut(s)	125
AjiI	CACGTC	1 cut(s)	276
AjnI	CCWGG	1 cut(s)	311
AluBI	AGCT	4 cut(s)	161, 207, 309, 405
AluI	AGCT	4 cut(s)	161, 207, 309, 405
Alw21I	GWGCWC	1 cut(s)	311
Alw26I	GTCTC	3 cut(s)	22, 247, 335
Ama87I	CYCGRG	1 cut(s)	202
ApoI	RAATTY	1 cut(s)	59
Asp700I	GAANNNNTTC	1 cut(s)	461
AspLEI	GCGC	1 cut(s)	95
AspS9I	GGNCC	1 cut(s)	193
AsuHPI	GGTGA	4 cut(s)	91, 348, 412, 481
AvaI	CYCGRG	1 cut(s)	202
AvaII	GGWCC	1 cut(s)	193
BaeGI	GKGCMC	2 cut(s)	334, 401
BanI	GGYRCC	1 cut(s)	396
BanII	GRGCYC	2 cut(s)	311, 471
BbsI	GAAGAC	2 cut(s)	371, 447
Bbv12I	GWGCWC	1 cut(s)	311
BciT130I	CCWGG	1 cut(s)	313
BcoDI	GTCTC	3 cut(s)	22, 247, 335
BfaI	CTAG	2 cut(s)	156, 402
Bme1390I	CCNGG	1 cut(s)	313
Bme18I	GGWCC	1 cut(s)	193
BmeT110I	CYCGRG	1 cut(s)	202
BmgBI	CACGTC	1 cut(s)	276
BmgT120I	GGNCC	1 cut(s)	193
BmiI	GGNNCC	1 cut(s)	398
BmrFI	CCNGG	1 cut(s)	313
BpiI	GAAGAC	2 cut(s)	371, 447
BpmI	CTGGAG	1 cut(s)	295
BpuEI	CTTGAG	1 cut(s)	46
Bsa29I	ATCGAT	1 cut(s)	450
BsaAI	YACGTR	1 cut(s)	323
BsaJI	CCNNGG	2 cut(s)	144, 359
BsaXI	ACNNNNNCTCC	2 cut(s)	91, 121
Bsc4I	CCNNNNNNNGG	1 cut(s)	375
Bse1I	ACTGG	1 cut(s)	88
BseBI	CCWGG	1 cut(s)	313
BseCI	ATCGAT	1 cut(s)	450
BseDI	CCNNGG	2 cut(s)	144, 359
BseGI	GGATG	1 cut(s)	10
BseLI	CCNNNNNNNGG	1 cut(s)	375
BseNI	ACTGG	1 cut(s)	88
BseSI	GKGCMC	2 cut(s)	334, 401
BseYI	CCCAGC	1 cut(s)	474
BshNI	GGYRCC	1 cut(s)	396
BshVI	ATCGAT	1 cut(s)	450
BsiHKAI	GWGCWC	1 cut(s)	311
BsiHKCI	CYCGRG	1 cut(s)	202
BsiWI	CGTACG	1 cut(s)	266
BslI	CCNNNNNNNGG	1 cut(s)	375
BsmAI	GTCTC	3 cut(s)	22, 247, 335
BsmBI	CGTCTC	1 cut(s)	247
BsoBI	CYCGRG	1 cut(s)	202
Bsp1286I	GDGCHC	4 cut(s)	311, 334, 401, 471
Bsp143I	GATC	3 cut(s)	281, 353, 387
Bsp19I	CCATGG	1 cut(s)	144
BspACI	CCGC	1 cut(s)	338
BspDI	ATCGAT	1 cut(s)	450
BspLI	GGNNCC	1 cut(s)	398
BspT107I	GGYRCC	1 cut(s)	396
BsrI	ACTGG	1 cut(s)	88
BssECI	CCNNGG	2 cut(s)	144, 359
BssMI	GATC	3 cut(s)	281, 353, 387
BssT1I	CCWWGG	2 cut(s)	144, 359
Bst2UI	CCWGG	1 cut(s)	313
Bst4CI	ACNGT	2 cut(s)	424, 493
Bst6I	CTCTTC	1 cut(s)	378
BstBAI	YACGTR	1 cut(s)	323
BstC8I	GCNNGC	1 cut(s)	163
BstDEI	CTNAG	1 cut(s)	498
BstDSI	CCRYGG	1 cut(s)	144
BstF5I	GGATG	1 cut(s)	10
BstHHI	GCGC	1 cut(s)	95
BstKTI	GATC	3 cut(s)	284, 356, 390
BstMAI	GTCTC	3 cut(s)	22, 247, 335
BstMBI	GATC	3 cut(s)	281, 353, 387
BstMWI	GCNNNNNNNGC	2 cut(s)	466, 475
BstNI	CCWGG	1 cut(s)	313
BstSCI	CCNGG	1 cut(s)	311
BstSLI	GKGCMC	2 cut(s)	334, 401
BstV2I	GAAGAC	2 cut(s)	371, 447
Bsu15I	ATCGAT	1 cut(s)	450
BsuTUI	ATCGAT	1 cut(s)	450
BtgI	CCRYGG	1 cut(s)	144
BtrI	CACGTC	1 cut(s)	276
BtsCI	GGATG	1 cut(s)	10
Cac8I	GCNNGC	1 cut(s)	163
CfoI	GCGC	1 cut(s)	95
Cfr13I	GGNCC	1 cut(s)	193
ClaI	ATCGAT	1 cut(s)	450
Csp6I	GTAC	4 cut(s)	267, 318, 324, 408
CviAII	CATG	2 cut(s)	145, 335
CviJI	RGCY	8 cut(s)	10, 161, 207, 253, 309, 405, 460, 469
CviKI_1	RGCY	8 cut(s)	10, 161, 207, 253, 309, 405, 460, 469
CviQI	GTAC	4 cut(s)	267, 318, 324, 408
DdeI	CTNAG	1 cut(s)	498
DpnI	GATC	3 cut(s)	283, 355, 389
DpnII	GATC	3 cut(s)	281, 353, 387
Eam1104I	CTCTTC	1 cut(s)	378
EarI	CTCTTC	1 cut(s)	378
Ecl136II	GAGCTC	1 cut(s)	309
Eco130I	CCWWGG	2 cut(s)	144, 359
Eco24I	GRGCYC	2 cut(s)	311, 471
Eco32I	GATATC	1 cut(s)	76
Eco47I	GGWCC	1 cut(s)	193
Eco53kI	GAGCTC	1 cut(s)	309
Eco88I	CYCGRG	1 cut(s)	202
EcoICRI	GAGCTC	1 cut(s)	309
EcoRII	CCWGG	1 cut(s)	311
EcoRV	GATATC	1 cut(s)	76
EcoT14I	CCWWGG	2 cut(s)	144, 359
EcoT38I	GRGCYC	2 cut(s)	311, 471
ErhI	CCWWGG	2 cut(s)	144, 359
Esp3I	CGTCTC	1 cut(s)	247
FaeI	CATG	2 cut(s)	148, 338
FaiI	YATR	8 cut(s)	44, 131, 146, 173, 210, 212, 292, 336
FalI	AAGNNNNNCTT	4 cut(s)	117, 149, 446, 478
FatI	CATG	2 cut(s)	144, 334
FokI	GGATG	1 cut(s)	17
FriOI	GRGCYC	2 cut(s)	311, 471
FspBI	CTAG	2 cut(s)	156, 402
GlaI	GCGC	1 cut(s)	94
GsaI	CCCAGC	1 cut(s)	478
GsuI	CTGGAG	1 cut(s)	295
HhaI	GCGC	1 cut(s)	95
Hin1II	CATG	2 cut(s)	148, 338
Hin6I	GCGC	1 cut(s)	93
HinP1I	GCGC	1 cut(s)	93
HphI	GGTGA	4 cut(s)	91, 348, 412, 481
Hpy166II	GTNNAC	2 cut(s)	320, 430
Hpy188I	TCNGA	1 cut(s)	218
Hpy188III	TCNNGA	1 cut(s)	351
Hpy8I	GTNNAC	2 cut(s)	320, 430
Hpy99I	CGWCG	6 cut(s)	274, 277, 307, 428, 440, 497
HpyAV	CCTTC	3 cut(s)	106, 120, 472
HpyCH4III	ACNGT	2 cut(s)	424, 493
HpyCH4IV	ACGT	3 cut(s)	275, 322, 435
HpyCH4V	TGCA	1 cut(s)	187
HpyF10VI	GCNNNNNNNGC	2 cut(s)	466, 475
HpyF3I	CTNAG	1 cut(s)	498
HpySE526I	ACGT	3 cut(s)	275, 322, 435
Hsp92II	CATG	2 cut(s)	148, 338
HspAI	GCGC	1 cut(s)	93
Kzo9I	GATC	3 cut(s)	281, 353, 387
LmnI	GCTCC	1 cut(s)	314
LpnPI	CCDG	7 cut(s)	69, 115, 147, 298, 325, 364, 488
MaeI	CTAG	2 cut(s)	156, 402
MaeII	ACGT	3 cut(s)	275, 322, 435
MalI	GATC	3 cut(s)	283, 355, 389
MboI	GATC	3 cut(s)	281, 353, 387
MboII	GAAGA	5 cut(s)	137, 298, 376, 395, 452
MhlI	GDGCHC	4 cut(s)	311, 334, 401, 471
MluCI	AATT	3 cut(s)	50, 59, 373
MnlI	CCTC	4 cut(s)	117, 214, 481, 497
MroXI	GAANNNNTTC	1 cut(s)	461
MseI	TTAA	1 cut(s)	371
MspR9I	CCNGG	1 cut(s)	313
MvaI	CCWGG	1 cut(s)	313
MwoI	GCNNNNNNNGC	2 cut(s)	466, 475
NcoI	CCATGG	1 cut(s)	144
NdeII	GATC	3 cut(s)	281, 353, 387
NlaIII	CATG	2 cut(s)	148, 338
NlaIV	GGNNCC	1 cut(s)	398
PaeR7I	CTCGAG	1 cut(s)	202
PcsI	WCGNNNNNNNCGW	2 cut(s)	281, 432
PdmI	GAANNNNTTC	1 cut(s)	461
Pfl23II	CGTACG	1 cut(s)	266
Ppu21I	YACGTR	1 cut(s)	323
PsiI	TTATAA	1 cut(s)	173
Psp124BI	GAGCTC	1 cut(s)	311
Psp6I	CCWGG	1 cut(s)	311
PspFI	CCCAGC	1 cut(s)	474
PspGI	CCWGG	1 cut(s)	311
PspLI	CGTACG	1 cut(s)	266
PspN4I	GGNNCC	1 cut(s)	398
PspPI	GGNCC	1 cut(s)	193
PspXI	VCTCGAGB	1 cut(s)	202
RsaI	GTAC	4 cut(s)	268, 319, 325, 409
RsaNI	GTAC	4 cut(s)	267, 318, 324, 408
SacI	GAGCTC	1 cut(s)	311
SaqAI	TTAA	1 cut(s)	371
Sau3AI	GATC	3 cut(s)	281, 353, 387
Sau96I	GGNCC	1 cut(s)	193
ScrFI	CCNGG	1 cut(s)	313
SduI	GDGCHC	4 cut(s)	311, 334, 401, 471
Sfr274I	CTCGAG	1 cut(s)	202
SinI	GGWCC	1 cut(s)	193
SlaI	CTCGAG	1 cut(s)	202
SmlI	CTYRAG	2 cut(s)	25, 202
SmoI	CTYRAG	2 cut(s)	25, 202
Sse9I	AATT	3 cut(s)	50, 59, 373
SsiI	CCGC	1 cut(s)	338
SspI	AATATT	1 cut(s)	39
SspMI	CTAG	2 cut(s)	156, 402
SstI	GAGCTC	1 cut(s)	311
StyD4I	CCNGG	1 cut(s)	311
StyI	CCWWGG	2 cut(s)	144, 359
TaaI	ACNGT	2 cut(s)	424, 493
TaiI	ACGT	3 cut(s)	278, 325, 438
TaqI	TCGA	5 cut(s)	203, 284, 438, 450, 465
TasI	AATT	3 cut(s)	50, 59, 373
TatI	WGTACW	1 cut(s)	407
Tru1I	TTAA	1 cut(s)	371
Tru9I	TTAA	1 cut(s)	371
TspDTI	ATGAA	2 cut(s)	102, 436
TspGWI	ACGGA	2 cut(s)	225, 229
VpaK11BI	GGWCC	1 cut(s)	193
XapI	RAATTY	1 cut(s)	59
XhoI	CTCGAG	1 cut(s)	202
XmnI	GAANNNNTTC	1 cut(s)	461
XspI	CTAG	2 cut(s)	156, 402

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.