Rh6DG091400

Diphthamide biosynthesis protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0002470
Physical Location & Seq
Reverse (-)
10668301 .. 10673518
5218 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG091400.1

Sequence Viewer

Length: 249 bp
ATGTCGTATGACGATGTGGAGATCGAAGATATGGAGTGGAACGACGAGCTCCAGGCATACACATACCCGTGCCCATGTGGAGACTTGTTCCAGATTACCAAGGAAGACCTGAAATTGGGAGAAGAGATTGCTCGGTGTCCTAGTTGTACTCTCTACATCACCGTTGTTTACAACATCGAAGATTTCATGGATAAGAAACCCACCAAACCCTTTGAGCCCTCCAAGCAACAATCCCTCACCATCGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-CSL

Protein Analysis

82

Amino Acids

9.54

Weight (kDa)

4.12

Isoelectric Point (pI)

77.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_CSL PF05207 4 - 58 5.1e-23 CSL zinc finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 148
AfiI CCNNNNNNNGG 1 cut(s) 115
AjnI CCWGG 1 cut(s) 51
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
Alw21I GWGCWC 1 cut(s) 51
Alw26I GTCTC 1 cut(s) 75
AsuHPI GGTGA 2 cut(s) 151, 229
BaeGI GKGCMC 1 cut(s) 74
BanII GRGCYC 2 cut(s) 51, 219
BbsI GAAGAC 1 cut(s) 111
Bbv12I GWGCWC 1 cut(s) 51
BccI CCATC 1 cut(s) 248
BciT130I CCWGG 1 cut(s) 53
BcoDI GTCTC 1 cut(s) 75
BfaI CTAG 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 53
BpiI GAAGAC 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 115
BseSI GKGCMC 1 cut(s) 74
BsiHKAI GWGCWC 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 75
Bsp1286I GDGCHC 3 cut(s) 51, 74, 219
Bsp143I GATC 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 21
BssT1I CCWWGG 1 cut(s) 99
Bst2UI CCWGG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 163
Bst6I CTCTTC 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 246
BstKTI GATC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 75
BstMBI GATC 1 cut(s) 21
BstMWI GCNNNNNNNGC 1 cut(s) 223
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BstSLI GKGCMC 1 cut(s) 74
BstV2I GAAGAC 1 cut(s) 111
BtgZI GCGATG 1 cut(s) 226
Csp6I GTAC 1 cut(s) 147
CviAII CATG 2 cut(s) 75, 187
CviJI RGCY 2 cut(s) 49, 217
CviKI_1 RGCY 2 cut(s) 49, 217
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 1 cut(s) 246
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eam1104I CTCTTC 1 cut(s) 117
EarI CTCTTC 1 cut(s) 117
Ecl136II GAGCTC 1 cut(s) 49
Eco130I CCWWGG 1 cut(s) 99
Eco24I GRGCYC 2 cut(s) 51, 219
Eco53kI GAGCTC 1 cut(s) 49
EcoICRI GAGCTC 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 99
EcoT38I GRGCYC 2 cut(s) 51, 219
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 2 cut(s) 78, 190
FaiI YATR 6 cut(s) 9, 32, 58, 64, 76, 188
FatI CATG 2 cut(s) 74, 186
FriOI GRGCYC 2 cut(s) 51, 219
FspBI CTAG 1 cut(s) 141
GsuI CTGGAG 1 cut(s) 35
Hin1II CATG 2 cut(s) 78, 190
HphI GGTGA 2 cut(s) 151, 229
Hpy166II GTNNAC 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 223
HpyF3I CTNAG 1 cut(s) 246
Hsp92II CATG 2 cut(s) 78, 190
Kzo9I GATC 1 cut(s) 21
LmnI GCTCC 1 cut(s) 54
LpnPI CCDG 4 cut(s) 38, 65, 104, 122
MaeI CTAG 1 cut(s) 141
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 4 cut(s) 38, 116, 134, 191
MhlI GDGCHC 3 cut(s) 51, 74, 219
MluCI AATT 1 cut(s) 113
MnlI CCTC 2 cut(s) 229, 245
MslI CAYNNNNRTG 1 cut(s) 67
MspR9I CCNGG 1 cut(s) 53
MvaI CCWGG 1 cut(s) 53
MwoI GCNNNNNNNGC 1 cut(s) 223
NdeII GATC 1 cut(s) 21
NlaIII CATG 2 cut(s) 78, 190
Psp124BI GAGCTC 1 cut(s) 51
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
RseI CAYNNNNRTG 1 cut(s) 67
SacI GAGCTC 1 cut(s) 51
Sau3AI GATC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 53
SduI GDGCHC 3 cut(s) 51, 74, 219
SetI ASST 2 cut(s) 51, 111
SmiMI CAYNNNNRTG 1 cut(s) 67
Sse9I AATT 1 cut(s) 113
SspMI CTAG 1 cut(s) 141
SstI GAGCTC 1 cut(s) 51
StyD4I CCNGG 1 cut(s) 51
StyI CCWWGG 1 cut(s) 99
TaaI ACNGT 1 cut(s) 163
TaqI TCGA 2 cut(s) 24, 177
TasI AATT 1 cut(s) 113
TatI WGTACW 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 175
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.