Rroxscaffold_7G00209280

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
59549280 .. 59556756
7477 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00209280.1

Sequence Viewer

Length: 180 bp
ATGAAACTTGAACGGAACGGAGTCGAAGGACCACTAACAACCTTCGCCAAACCGAATTATGAGAGTACCACTTCGGTCACGGAGGGCTTGATGCTACTTCACTCAGGAATAAAGGTGGCAAACAGTGATAGGATTACAACGGAAATATCAAGTACATTGATGATACTAAATGCTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.4

Weight (kDa)

5.16

Isoelectric Point (pI)

18.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 67, 154
AgsI TTSAA 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 29
AvaII GGWCC 1 cut(s) 29
Bme18I GGWCC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 29
BmsI GCATC 1 cut(s) 81
BseMII CTCAG 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 103
BtsIMutI CAGTG 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 29
Csp6I GTAC 2 cut(s) 66, 153
CviJI RGCY 1 cut(s) 87
CviKI_1 RGCY 1 cut(s) 87
CviQI GTAC 2 cut(s) 66, 153
DdeI CTNAG 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 29
FaiI YATR 1 cut(s) 60
HinfI GANTC 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 20, 52
HpyCH4III ACNGT 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 103
LpnPI CCDG 1 cut(s) 90
LweI GCATC 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 76
MluCI AATT 1 cut(s) 55
MlyI GAGTC 1 cut(s) 30
MnlI CCTC 1 cut(s) 76
NmuCI GTSAC 1 cut(s) 76
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 29
RsaI GTAC 2 cut(s) 67, 154
RsaNI GTAC 2 cut(s) 66, 153
Sau96I GGNCC 1 cut(s) 29
SchI GAGTC 1 cut(s) 30
SetI ASST 2 cut(s) 44, 117
SfaNI GCATC 1 cut(s) 81
SgeI CNNG 5 cut(s) 20, 91, 100, 117, 162
SinI GGWCC 1 cut(s) 29
Sse9I AATT 1 cut(s) 55
TaaI ACNGT 1 cut(s) 125
TaqI TCGA 1 cut(s) 24
TaqII GACCGA 1 cut(s) 64
TasI AATT 1 cut(s) 55
TatI WGTACW 1 cut(s) 152
TscAI CASTG 1 cut(s) 130
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 4 cut(s) 28, 33, 95, 155
TspRI CASTG 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.