Rorug01G0129300

heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
21986016 .. 21986189
174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0129300.1

Sequence Viewer

Length: 174 bp
ATGATGACATTTCAGTCTTCTCACATATTCGGTGAAGGGAATAAAGTTGCAGATGCTTTAGCAAAGTATGGTTCATCTTCTTTTGAAATGGTGTGGTGGGATTCACCTCCTTCATTTATCCTTTTGCACTATAAGAATGATCGTCGGGGTCTTCCTCAATTTCGTTTTCGTTAA

Protein Analysis

57

Amino Acids

6.69

Weight (kDa)

9.4

Isoelectric Point (pI)

75.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 13
AgsI TTSAA 1 cut(s) 86
AsuHPI GGTGA 2 cut(s) 44, 96
BbsI GAAGAC 2 cut(s) 9, 143
BmsI GCATC 1 cut(s) 43
BpiI GAAGAC 2 cut(s) 9, 143
Bsp143I GATC 1 cut(s) 139
BssMI GATC 1 cut(s) 139
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstV2I GAAGAC 2 cut(s) 9, 143
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
DrdI GACNNNNNNGTC 1 cut(s) 13
DseDI GACNNNNNNGTC 1 cut(s) 13
FaiI YATR 3 cut(s) 26, 69, 132
HinfI GANTC 1 cut(s) 101
HphI GGTGA 2 cut(s) 44, 96
Hpy99I CGWCG 1 cut(s) 147
HpyAV CCTTC 2 cut(s) 29, 120
HpyCH4V TGCA 2 cut(s) 50, 127
Kzo9I GATC 1 cut(s) 139
LweI GCATC 1 cut(s) 43
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 3 cut(s) 9, 69, 143
MluCI AATT 1 cut(s) 158
MnlI CCTC 2 cut(s) 117, 165
MseI TTAA 1 cut(s) 172
NdeII GATC 1 cut(s) 139
PfeI GAWTC 1 cut(s) 101
SaqAI TTAA 1 cut(s) 172
Sau3AI GATC 1 cut(s) 139
SetI ASST 1 cut(s) 109
SfaNI GCATC 1 cut(s) 43
SgeI CNNG 1 cut(s) 158
Sse9I AATT 1 cut(s) 158
TasI AATT 1 cut(s) 158
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
TspDTI ATGAA 2 cut(s) 63, 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.