Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000002

Orthogroup ID

OG0008342

Physical Location & Seq

Genomic Coordinates Forward (+)

17215260 .. 17215505

Gene Structure 246 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug02G0185200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 246 bp

ATGCCTATGTTTACAAGTAAGTTCTCTGCCAGGTCCTTGGGTATAGTTGAAGCTCCTGGAAATATTTTAGTGCCTAAAGATTTCATGCCAACAAGCTCTGGAACAAAGAAGAAAAGAGGAAGGCCTCTGGGATCAAGGAATAAAAATCCCCCAAAGTCAAAGAAGGTTGCGGATGCGCAAGAGACTTGTTTTGCTTATCTCTCCAAACCTCCTAGCCCAACTGTTAAGGGCAAGGAGAAAATTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

81

Amino Acids

8.79

Weight (kDa)

10.39

Isoelectric Point (pI)

55.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008342)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G22320
prunus_persica	Prupe.6G188500_v2.0.a1 Prupe.6G188600_v2.0.a1
rosa_laevigata	RLG00000018040 RLG00000018041 RLG00000018042 RLG00000018043
rosa_roxburghii	Rroxscaffold_2G00129640 Rroxscaffold_2G00129650 Rroxscaffold_2G00129670 Rroxscaffold_2G00129680
rosa_rugosa	Rorug02G0185000 Rorug02G0185100 Rorug02G0185200
rosa_samantha	Rh2AG239500 Rh2AG239600 Rh2BG253200 Rh2BG253400 Rh2BG253600 Rh2CG243400 Rh2CG243600 Rh2CG243700 Rh2DG247500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	177
AciI	CCGC	1 cut(s)	170
AclWI	GGATC	1 cut(s)	139
AcsI	RAATTY	1 cut(s)	240
AgsI	TTSAA	1 cut(s)	50
AjnI	CCWGG	2 cut(s)	29, 55
AluBI	AGCT	2 cut(s)	53, 96
AluI	AGCT	2 cut(s)	53, 96
Alw26I	GTCTC	1 cut(s)	176
AlwI	GGATC	1 cut(s)	139
AoxI	GGCC	1 cut(s)	122
ApoI	RAATTY	1 cut(s)	240
AspLEI	GCGC	1 cut(s)	178
AspS9I	GGNCC	1 cut(s)	33
AvaII	GGWCC	1 cut(s)	33
BciT130I	CCWGG	2 cut(s)	31, 57
BcoDI	GTCTC	1 cut(s)	176
BfaI	CTAG	1 cut(s)	213
Bme1390I	CCNGG	2 cut(s)	31, 57
Bme18I	GGWCC	1 cut(s)	33
BmgT120I	GGNCC	1 cut(s)	33
BmrFI	CCNGG	2 cut(s)	31, 57
BmsI	GCATC	1 cut(s)	163
BsaJI	CCNNGG	1 cut(s)	36
BseBI	CCWGG	2 cut(s)	31, 57
BseDI	CCNNGG	1 cut(s)	36
BseGI	GGATG	1 cut(s)	178
BshFI	GGCC	1 cut(s)	124
BsmAI	GTCTC	1 cut(s)	176
BsnI	GGCC	1 cut(s)	124
Bsp143I	GATC	1 cut(s)	131
BspACI	CCGC	1 cut(s)	170
BspANI	GGCC	1 cut(s)	124
BspPI	GGATC	1 cut(s)	139
BssECI	CCNNGG	1 cut(s)	36
BssMI	GATC	1 cut(s)	131
BssT1I	CCWWGG	1 cut(s)	36
Bst2UI	CCWGG	2 cut(s)	31, 57
Bst4CI	ACNGT	1 cut(s)	223
BstF5I	GGATG	1 cut(s)	178
BstHHI	GCGC	1 cut(s)	178
BstKTI	GATC	1 cut(s)	134
BstMAI	GTCTC	1 cut(s)	176
BstMBI	GATC	1 cut(s)	131
BstNI	CCWGG	2 cut(s)	31, 57
BstSCI	CCNGG	2 cut(s)	29, 55
BstXI	CCANNNNNNTGG	1 cut(s)	37
BsuRI	GGCC	1 cut(s)	124
BtsCI	GGATG	1 cut(s)	178
CfoI	GCGC	1 cut(s)	178
Cfr13I	GGNCC	1 cut(s)	33
CviAII	CATG	1 cut(s)	85
CviJI	RGCY	4 cut(s)	53, 96, 124, 216
CviKI_1	RGCY	4 cut(s)	53, 96, 124, 216
DpnI	GATC	1 cut(s)	133
DpnII	GATC	1 cut(s)	131
Eco130I	CCWWGG	1 cut(s)	36
Eco147I	AGGCCT	1 cut(s)	124
Eco47I	GGWCC	1 cut(s)	33
EcoO109I	RGGNCCY	1 cut(s)	33
EcoRII	CCWGG	2 cut(s)	29, 55
EcoT14I	CCWWGG	1 cut(s)	36
ErhI	CCWWGG	1 cut(s)	36
FaeI	CATG	1 cut(s)	88
FaiI	YATR	3 cut(s)	8, 44, 86
FatI	CATG	1 cut(s)	84
FokI	GGATG	1 cut(s)	185
FspBI	CTAG	1 cut(s)	213
FspI	TGCGCA	1 cut(s)	177
GlaI	GCGC	1 cut(s)	177
HaeIII	GGCC	1 cut(s)	124
HhaI	GCGC	1 cut(s)	178
Hin1II	CATG	1 cut(s)	88
Hin6I	GCGC	1 cut(s)	176
HinP1I	GCGC	1 cut(s)	176
Hpy166II	GTNNAC	1 cut(s)	12
Hpy188III	TCNNGA	1 cut(s)	99
Hpy8I	GTNNAC	1 cut(s)	12
HpyAV	CCTTC	2 cut(s)	114, 157
HpyCH4III	ACNGT	1 cut(s)	223
Hsp92II	CATG	1 cut(s)	88
HspAI	GCGC	1 cut(s)	176
Kzo9I	GATC	1 cut(s)	131
LmnI	GCTCC	1 cut(s)	58
LpnPI	CCDG	6 cut(s)	16, 42, 43, 69, 84, 113
LweI	GCATC	1 cut(s)	163
MaeI	CTAG	1 cut(s)	213
MalI	GATC	1 cut(s)	133
MboI	GATC	1 cut(s)	131
MboII	GAAGA	1 cut(s)	121
MluCI	AATT	1 cut(s)	240
MnlI	CCTC	3 cut(s)	110, 135, 219
MseI	TTAA	1 cut(s)	225
MspR9I	CCNGG	2 cut(s)	31, 57
MvaI	CCWGG	2 cut(s)	31, 57
NdeII	GATC	1 cut(s)	131
NlaIII	CATG	1 cut(s)	88
NsbI	TGCGCA	1 cut(s)	177
PceI	AGGCCT	1 cut(s)	124
PfoI	TCCNGGA	1 cut(s)	55
PpuMI	RGGWCCY	1 cut(s)	33
Psp5II	RGGWCCY	1 cut(s)	33
Psp6I	CCWGG	2 cut(s)	29, 55
PspGI	CCWGG	2 cut(s)	29, 55
PspPI	GGNCC	1 cut(s)	33
PspPPI	RGGWCCY	1 cut(s)	33
SaqAI	TTAA	1 cut(s)	225
Sau3AI	GATC	1 cut(s)	131
Sau96I	GGNCC	1 cut(s)	33
ScrFI	CCNGG	2 cut(s)	31, 57
SetI	ASST	5 cut(s)	35, 55, 98, 168, 211
SfaNI	GCATC	1 cut(s)	163
SinI	GGWCC	1 cut(s)	33
Sse9I	AATT	1 cut(s)	240
SseBI	AGGCCT	1 cut(s)	124
SsiI	CCGC	1 cut(s)	170
SspI	AATATT	1 cut(s)	64
SspMI	CTAG	1 cut(s)	213
StuI	AGGCCT	1 cut(s)	124
StyD4I	CCNGG	2 cut(s)	29, 55
StyI	CCWWGG	1 cut(s)	36
TaaI	ACNGT	1 cut(s)	223
TasI	AATT	1 cut(s)	240
Tru1I	TTAA	1 cut(s)	225
Tru9I	TTAA	1 cut(s)	225
TspDTI	ATGAA	1 cut(s)	73
VpaK11BI	GGWCC	1 cut(s)	33
XapI	RAATTY	1 cut(s)	240
XspI	CTAG	1 cut(s)	213

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.