Rorug02G0265000

Transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0010583
Physical Location & Seq
Forward (+)
27962293 .. 27962642
350 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0265000.1

Sequence Viewer

Length: 246 bp
ATGGCTATAGTACCATGCAAGCGTCTTGTTCTTTCTATTCTTATCTTGGTTTGCTTCATCTCTATCACTGCTAGAGCAAGGAGTTTGCAAGTGGCACATAGCAGTAATGGAAGTGATCGTCAACAAGGCATGGACTATAAGTTTCCATCAAACCAAGATGATGTTCTTGATGGGACTACCGAGGAAGTAAATCTTGCGGATTACAGTCGGCCAAGGCCACGTCCTCCGTCTGAGATCTTGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HLH

Protein Analysis

81

Amino Acids

9.0

Weight (kDa)

6.53

Isoelectric Point (pI)

62.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GLV1-2 PF21529 11 - 76 1.9e-09 Gloven 1/2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 197
AcoI YGGCCR 1 cut(s) 209
AfaI GTAC 1 cut(s) 12
AjiI CACGTC 1 cut(s) 221
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AoxI GGCC 2 cut(s) 209, 215
BccI CCATC 2 cut(s) 154, 164
BfaI CTAG 1 cut(s) 72
BfmI CTRYAG 1 cut(s) 6
BglII AGATCT 1 cut(s) 234
BmgBI CACGTC 1 cut(s) 221
BsaJI CCNNGG 2 cut(s) 180, 212
BseDI CCNNGG 2 cut(s) 180, 212
BseMII CTCAG 1 cut(s) 222
BshFI GGCC 2 cut(s) 211, 217
BslFI GGGAC 1 cut(s) 187
BsmFI GGGAC 1 cut(s) 187
BsnI GGCC 2 cut(s) 211, 217
Bsp143I GATC 2 cut(s) 115, 234
BspACI CCGC 1 cut(s) 197
BspANI GGCC 2 cut(s) 211, 217
BspCNI CTCAG 1 cut(s) 223
BssECI CCNNGG 2 cut(s) 180, 212
BssMI GATC 2 cut(s) 115, 234
BssT1I CCWWGG 1 cut(s) 212
Bst4CI ACNGT 1 cut(s) 206
BstC8I GCNNGC 1 cut(s) 20
BstDEI CTNAG 2 cut(s) 231, 243
BstKTI GATC 2 cut(s) 118, 237
BstMBI GATC 2 cut(s) 115, 234
BstSFI CTRYAG 1 cut(s) 6
BstX2I RGATCY 1 cut(s) 234
BstYI RGATCY 1 cut(s) 234
BsuRI GGCC 2 cut(s) 211, 217
BtrI CACGTC 1 cut(s) 221
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 20
CseI GACGC 1 cut(s) 11
Csp6I GTAC 1 cut(s) 11
CviAII CATG 2 cut(s) 15, 130
CviJI RGCY 3 cut(s) 5, 211, 217
CviKI_1 RGCY 3 cut(s) 5, 211, 217
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 2 cut(s) 231, 243
DpnI GATC 2 cut(s) 117, 236
DpnII GATC 2 cut(s) 115, 234
EaeI YGGCCR 1 cut(s) 209
Eco130I CCWWGG 1 cut(s) 212
EcoT14I CCWWGG 1 cut(s) 212
ErhI CCWWGG 1 cut(s) 212
FaeI CATG 2 cut(s) 18, 133
FaiI YATR 5 cut(s) 8, 16, 99, 131, 138
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FaqI GGGAC 1 cut(s) 187
FatI CATG 2 cut(s) 14, 129
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 2 cut(s) 211, 217
HgaI GACGC 1 cut(s) 11
Hin1II CATG 2 cut(s) 18, 133
HincII GTYRAC 1 cut(s) 122
HindII GTYRAC 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 2 cut(s) 167, 238
Hpy8I GTNNAC 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 18, 88
HpyF3I CTNAG 2 cut(s) 231, 243
HpySE526I ACGT 1 cut(s) 220
Hsp92II CATG 2 cut(s) 18, 133
Kzo9I GATC 2 cut(s) 115, 234
MaeI CTAG 1 cut(s) 72
MaeII ACGT 1 cut(s) 220
MalI GATC 2 cut(s) 117, 236
MboI GATC 2 cut(s) 115, 234
MflI RGATCY 1 cut(s) 234
MnlI CCTC 2 cut(s) 175, 234
NdeII GATC 2 cut(s) 115, 234
NlaIII CATG 2 cut(s) 18, 133
PsuI RGATCY 1 cut(s) 234
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
Sau3AI GATC 2 cut(s) 115, 234
SetI ASST 1 cut(s) 223
SfcI CTRYAG 1 cut(s) 6
SsiI CCGC 1 cut(s) 197
SspMI CTAG 1 cut(s) 72
StyI CCWWGG 1 cut(s) 212
TaaI ACNGT 1 cut(s) 206
TaiI ACGT 1 cut(s) 223
TscAI CASTG 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 46
TspGWI ACGGA 1 cut(s) 216
TspRI CASTG 1 cut(s) 73
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.