Rorug02G0356000

Isochorismatase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
44968340 .. 44969843
1504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0356000.1

Sequence Viewer

Length: 285 bp
ATGCCAAAGAAGATGAAGATGGCTATCCTCAATCCCATTTTTCTAATTGTTCTCATCAGCTCATTACAGATCTCTTTGGGTACTTCTGCTTTGGCTGAAGTAGCAACTACTTCACAAGTGTATGCAGGGTTACAGAAAACCTGGTTTTTGAAGTACAAAGATAATGATTATGCCCCAAAACCTTCACCACCGCCAGCTCCGAAACCTAGTCCGCCAAAAGTACCAATTTCAGAAGACGTCCTATCCGAGAGAGCTCCCCCAAGTCCGTACATAGCTTCAGCTTGA

Protein Analysis

94

Amino Acids

10.15

Weight (kDa)

9.48

Isoelectric Point (pI)

76.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 240
AciI CCGC 2 cut(s) 191, 212
AcuI CTGAAG 2 cut(s) 117, 261
AcyI GRCGYC 1 cut(s) 237
AfaI GTAC 4 cut(s) 82, 155, 222, 269
AgsI TTSAA 1 cut(s) 151
AjnI CCWGG 1 cut(s) 140
AluBI AGCT 5 cut(s) 60, 197, 254, 275, 281
AluI AGCT 5 cut(s) 60, 197, 254, 275, 281
Alw21I GWGCWC 1 cut(s) 256
AsuHPI GGTGA 1 cut(s) 177
BanII GRGCYC 1 cut(s) 256
BbsI GAAGAC 1 cut(s) 240
Bbv12I GWGCWC 1 cut(s) 256
BccI CCATC 1 cut(s) 13
BciT130I CCWGG 1 cut(s) 142
BfaI CTAG 1 cut(s) 207
BglII AGATCT 1 cut(s) 69
Bme1390I CCNGG 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 240
BsaBI GATNNNNATC 1 cut(s) 23
BsaHI GRCGYC 1 cut(s) 237
Bse8I GATNNNNATC 1 cut(s) 23
BseBI CCWGG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 23
BsiHKAI GWGCWC 1 cut(s) 256
Bsp1286I GDGCHC 1 cut(s) 256
Bsp143I GATC 1 cut(s) 69
BspACI CCGC 2 cut(s) 191, 212
BssMI GATC 1 cut(s) 69
BssNI GRCGYC 1 cut(s) 237
Bst2UI CCWGG 1 cut(s) 142
BstACI GRCGYC 1 cut(s) 237
BstC8I GCNNGC 1 cut(s) 195
BstKTI GATC 1 cut(s) 72
BstMBI GATC 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstV2I GAAGAC 1 cut(s) 240
BstX2I RGATCY 1 cut(s) 69
BstYI RGATCY 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 195
CsiI ACCWGGT 1 cut(s) 140
Csp6I GTAC 4 cut(s) 81, 154, 221, 268
CviJI RGCY 7 cut(s) 23, 60, 95, 197, 254, 275, 281
CviKI_1 RGCY 7 cut(s) 23, 60, 95, 197, 254, 275, 281
CviQI GTAC 4 cut(s) 81, 154, 221, 268
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
EciI GGCGGA 1 cut(s) 201
Ecl136II GAGCTC 1 cut(s) 254
Eco24I GRGCYC 1 cut(s) 256
Eco53kI GAGCTC 1 cut(s) 254
Eco57I CTGAAG 2 cut(s) 117, 261
EcoICRI GAGCTC 1 cut(s) 254
EcoRII CCWGG 1 cut(s) 140
EcoT38I GRGCYC 1 cut(s) 256
FaiI YATR 3 cut(s) 123, 171, 272
FriOI GRGCYC 1 cut(s) 256
FspBI CTAG 1 cut(s) 207
Hin1I GRCGYC 1 cut(s) 237
HphI GGTGA 1 cut(s) 177
Hpy188I TCNGA 3 cut(s) 201, 232, 247
HpyAV CCTTC 1 cut(s) 192
HpyCH4IV ACGT 1 cut(s) 237
HpyCH4V TGCA 1 cut(s) 125
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
HpySE526I ACGT 1 cut(s) 237
Hsp92I GRCGYC 1 cut(s) 237
Kzo9I GATC 1 cut(s) 69
LmnI GCTCC 2 cut(s) 202, 259
LpnPI CCDG 4 cut(s) 111, 127, 154, 207
MabI ACCWGGT 1 cut(s) 140
MaeI CTAG 1 cut(s) 207
MaeII ACGT 1 cut(s) 237
MaeIII GTNAC 1 cut(s) 129
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 3 cut(s) 22, 28, 245
MflI RGATCY 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 256
MluCI AATT 2 cut(s) 45, 225
MnlI CCTC 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 1 cut(s) 69
PcsI WCGNNNNNNNCGW 1 cut(s) 243
Psp124BI GAGCTC 1 cut(s) 256
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
PsuI RGATCY 1 cut(s) 69
RsaI GTAC 4 cut(s) 82, 155, 222, 269
RsaNI GTAC 4 cut(s) 81, 154, 221, 268
SacI GAGCTC 1 cut(s) 256
Sau3AI GATC 1 cut(s) 69
ScrFI CCNGG 1 cut(s) 142
SduI GDGCHC 1 cut(s) 256
SetI ASST 9 cut(s) 62, 143, 184, 199, 208, 240, 256, 277, 283
SexAI ACCWGGT 1 cut(s) 140
SgeI CNNG 8 cut(s) 128, 138, 153, 154, 206, 219, 259, 273
Sse9I AATT 2 cut(s) 45, 225
SsiI CCGC 2 cut(s) 191, 212
SspMI CTAG 1 cut(s) 207
SstI GAGCTC 1 cut(s) 256
StyD4I CCNGG 1 cut(s) 140
TaiI ACGT 1 cut(s) 240
TasI AATT 2 cut(s) 45, 225
TatI WGTACW 1 cut(s) 153
TspDTI ATGAA 1 cut(s) 29
TspGWI ACGGA 1 cut(s) 255
XspI CTAG 1 cut(s) 207
ZraI GACGTC 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.