Rorug02G0397700

sugar transporter

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
50794015 .. 50794323
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0397700.1

Sequence Viewer

Length: 153 bp
ATGGAAAGACCGGAGAGCAGAAGCTTGTGTTGGGACATCTCATTCCCGGTCAAATCCCACAGTTGTCATTTGATTTGGTCCTTGATGATGAGTTTGAACTATCCCACAACTGGAAAAGTGGTATTGTCCACTTTGCTGGTTATCAATCCGTAA

Protein Analysis

50

Amino Acids

5.72

Weight (kDa)

7.85

Isoelectric Point (pI)

63.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 1 cut(s) 97
AjuI GAANNNNNNNTTGG 2 cut(s) 13, 45
AluBI AGCT 1 cut(s) 24
AluI AGCT 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 78
AsuC2I CCSGG 1 cut(s) 47
AvaII GGWCC 1 cut(s) 78
BcnI CCSGG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 47
Bme18I GGWCC 1 cut(s) 78
BmgT120I GGNCC 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 47
BpuMI CCSGG 1 cut(s) 47
BsaWI WCCGGW 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 115
BsiSI CCGG 2 cut(s) 11, 47
BslFI GGGAC 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 110
BsmFI GGGAC 1 cut(s) 47
BsrI ACTGG 1 cut(s) 115
Bst4CI ACNGT 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 45
BstXI CCANNNNNNTGG 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 78
CviJI RGCY 1 cut(s) 24
CviKI_1 RGCY 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 78
FaqI GGGAC 1 cut(s) 47
HapII CCGG 2 cut(s) 11, 47
HindIII AAGCTT 1 cut(s) 22
HpaII CCGG 2 cut(s) 11, 47
Hpy166II GTNNAC 1 cut(s) 129
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 62
LpnPI CCDG 4 cut(s) 24, 60, 96, 122
MspI CCGG 2 cut(s) 11, 47
MspR9I CCNGG 1 cut(s) 47
NciI CCSGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 78
Sau96I GGNCC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 47
SetI ASST 1 cut(s) 26
SgeI CNNG 7 cut(s) 23, 37, 58, 59, 94, 123, 149
SinI GGWCC 1 cut(s) 78
StyD4I CCNGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 62
TspGWI ACGGA 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.