Rorug02G0428600

callose synthase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
54921061 .. 54921438
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0428600.1

Sequence Viewer

Length: 300 bp
ATGGAAGAAGAGCCCCTAGATTCTGGGTTGCAAATTTCTCTGTCTTCAGATGGTATCGAAGAAGACTTACAATCTAATCACACATCTAGTATCATTGAAGGCCCCAATGTCAATGGCTCCTCTATGATTGATGCTTCTGATGAATTCCTGTCATTATCGACTAAACTTTTTGAAAACCGAGAAGACCTCATTAGTGATGTTCGTAAGATTGGGTTGTTGCAAGGGTATGTTATGGTAATCAAAAGATCTAAAGGCAATAGATATGTGGCAATAGATATTCTGGTAAGATCTAAGAGATAG

Protein Analysis

99

Amino Acids

11.0

Weight (kDa)

4.66

Isoelectric Point (pI)

64.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 33, 143
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 2 cut(s) 98, 173
AoxI GGCC 1 cut(s) 100
ApoI RAATTY 2 cut(s) 33, 143
AspS9I GGNCC 1 cut(s) 101
BanII GRGCYC 1 cut(s) 15
BarI GAAGNNNNNNTAC 2 cut(s) 51, 83
BbsI GAAGAC 3 cut(s) 36, 69, 189
BccI CCATC 1 cut(s) 44
BfaI CTAG 2 cut(s) 17, 87
BglII AGATCT 2 cut(s) 245, 287
BmgT120I GGNCC 1 cut(s) 101
BmiI GGNNCC 2 cut(s) 103, 118
BmsI GCATC 1 cut(s) 121
BpiI GAAGAC 3 cut(s) 36, 69, 189
BplI GAGNNNNNCTC 2 cut(s) 171, 203
BseRI GAGGAG 1 cut(s) 109
BshFI GGCC 1 cut(s) 102
BsnI GGCC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 15
Bsp143I GATC 2 cut(s) 245, 287
BspANI GGCC 1 cut(s) 102
BspLI GGNNCC 2 cut(s) 103, 118
BspQI GCTCTTC 1 cut(s) 3
BssMI GATC 2 cut(s) 245, 287
Bst6I CTCTTC 1 cut(s) 3
BstDEI CTNAG 1 cut(s) 291
BstKTI GATC 2 cut(s) 248, 290
BstMBI GATC 2 cut(s) 245, 287
BstV2I GAAGAC 3 cut(s) 36, 69, 189
BstX2I RGATCY 2 cut(s) 245, 287
BstYI RGATCY 2 cut(s) 245, 287
BsuRI GGCC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 101
CviJI RGCY 3 cut(s) 13, 102, 117
CviKI_1 RGCY 3 cut(s) 13, 102, 117
DdeI CTNAG 1 cut(s) 291
DpnI GATC 2 cut(s) 247, 289
DpnII GATC 2 cut(s) 245, 287
Eam1104I CTCTTC 1 cut(s) 3
EarI CTCTTC 1 cut(s) 3
Eco24I GRGCYC 1 cut(s) 15
Eco57I CTGAAG 1 cut(s) 30
EcoO109I RGGNCCY 1 cut(s) 101
EcoRI GAATTC 1 cut(s) 143
EcoT38I GRGCYC 1 cut(s) 15
FaiI YATR 4 cut(s) 125, 228, 233, 264
FriOI GRGCYC 1 cut(s) 15
FspBI CTAG 2 cut(s) 17, 87
HaeIII GGCC 1 cut(s) 102
HinfI GANTC 1 cut(s) 20
Hpy188I TCNGA 2 cut(s) 49, 139
HpyAV CCTTC 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 31, 220
HpyF3I CTNAG 1 cut(s) 291
Kzo9I GATC 2 cut(s) 245, 287
LguI GCTCTTC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 122
LpnPI CCDG 3 cut(s) 9, 161, 266
LweI GCATC 1 cut(s) 121
MaeI CTAG 2 cut(s) 17, 87
MalI GATC 2 cut(s) 247, 289
MboI GATC 2 cut(s) 245, 287
MboII GAAGA 6 cut(s) 17, 20, 36, 71, 74, 194
MflI RGATCY 2 cut(s) 245, 287
MhlI GDGCHC 1 cut(s) 15
MluCI AATT 2 cut(s) 33, 143
MnlI CCTC 2 cut(s) 130, 197
NdeII GATC 2 cut(s) 245, 287
NlaIV GGNNCC 2 cut(s) 103, 118
PciSI GCTCTTC 1 cut(s) 3
PfeI GAWTC 1 cut(s) 20
PspN4I GGNNCC 2 cut(s) 103, 118
PspPI GGNCC 1 cut(s) 101
PsuI RGATCY 2 cut(s) 245, 287
SapI GCTCTTC 1 cut(s) 3
Sau3AI GATC 2 cut(s) 245, 287
Sau96I GGNCC 1 cut(s) 101
SduI GDGCHC 1 cut(s) 15
SetI ASST 1 cut(s) 189
SfaNI GCATC 1 cut(s) 121
SgeI CNNG 7 cut(s) 29, 36, 99, 160, 191, 233, 293
Sse9I AATT 2 cut(s) 33, 143
SspMI CTAG 2 cut(s) 17, 87
TaqI TCGA 2 cut(s) 57, 158
TasI AATT 2 cut(s) 33, 143
TfiI GAWTC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 156
XapI RAATTY 2 cut(s) 33, 143
XspI CTAG 2 cut(s) 17, 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.