Rorug04G0019200

Belongs to the OSBP family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
2850789 .. 2851587
799 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0019200.1

Sequence Viewer

Length: 174 bp
ATGAGAATAGAAGACGAATCTGAGATGAAAATTGCAAAGGTTAAAGTGGGAAGTTGGTACTTGGAGGCTTTCAAAAAGAGGTTCCTGGAGAAAAGCTTCAATTGGCTACAAAATTTGGTATTGTCAAGTCAGACGGCTTTAATTTGGTATAAATGGGATTCCAGGATATGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.95

Weight (kDa)

9.25

Isoelectric Point (pI)

42.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 112
AfaI GTAC 1 cut(s) 59
AgsI TTSAA 2 cut(s) 73, 100
AjnI CCWGG 2 cut(s) 84, 161
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
ApoI RAATTY 1 cut(s) 112
Asp700I GAANNNNTTC 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 18
BceAI ACGGC 1 cut(s) 150
BciT130I CCWGG 2 cut(s) 86, 163
Bme1390I CCNGG 2 cut(s) 86, 163
BmiI GGNNCC 1 cut(s) 83
BmrFI CCNGG 2 cut(s) 86, 163
BpiI GAAGAC 1 cut(s) 18
BpmI CTGGAG 1 cut(s) 107
BseBI CCWGG 2 cut(s) 86, 163
BseMII CTCAG 1 cut(s) 12
BspCNI CTCAG 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 83
Bst2UI CCWGG 2 cut(s) 86, 163
BstDEI CTNAG 1 cut(s) 21
BstNI CCWGG 2 cut(s) 86, 163
BstSCI CCNGG 2 cut(s) 84, 161
BstV2I GAAGAC 1 cut(s) 18
Csp6I GTAC 1 cut(s) 58
CviJI RGCY 4 cut(s) 68, 96, 106, 137
CviKI_1 RGCY 4 cut(s) 68, 96, 106, 137
CviQI GTAC 1 cut(s) 58
DdeI CTNAG 1 cut(s) 21
EcoRII CCWGG 2 cut(s) 84, 161
FaiI YATR 2 cut(s) 150, 169
GsuI CTGGAG 1 cut(s) 107
HindIII AAGCTT 1 cut(s) 94
HinfI GANTC 2 cut(s) 17, 158
Hpy188I TCNGA 2 cut(s) 22, 132
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 21
LpnPI CCDG 3 cut(s) 71, 98, 148
MboII GAAGA 1 cut(s) 23
MfeI CAATTG 1 cut(s) 100
MluCI AATT 4 cut(s) 30, 100, 112, 141
MnlI CCTC 2 cut(s) 58, 72
MroXI GAANNNNTTC 1 cut(s) 95
MseI TTAA 2 cut(s) 42, 140
MspR9I CCNGG 2 cut(s) 86, 163
MunI CAATTG 1 cut(s) 100
MvaI CCWGG 2 cut(s) 86, 163
NlaIV GGNNCC 1 cut(s) 83
PdmI GAANNNNTTC 1 cut(s) 95
PfeI GAWTC 2 cut(s) 17, 158
PfoI TCCNGGA 2 cut(s) 84, 161
Psp6I CCWGG 2 cut(s) 84, 161
PspGI CCWGG 2 cut(s) 84, 161
PspN4I GGNNCC 1 cut(s) 83
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
SaqAI TTAA 2 cut(s) 42, 140
ScrFI CCNGG 2 cut(s) 86, 163
SetI ASST 3 cut(s) 42, 83, 98
SgeI CNNG 4 cut(s) 73, 97, 98, 138
Sse9I AATT 4 cut(s) 30, 100, 112, 141
StyD4I CCNGG 2 cut(s) 84, 161
TasI AATT 4 cut(s) 30, 100, 112, 141
TfiI GAWTC 2 cut(s) 17, 158
Tru1I TTAA 2 cut(s) 42, 140
Tru9I TTAA 2 cut(s) 42, 140
TspDTI ATGAA 1 cut(s) 41
XapI RAATTY 1 cut(s) 112
XmnI GAANNNNTTC 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.