Rorug04G0167600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0007276
Physical Location & Seq
Forward (+)
29479280 .. 29479474
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0167600.1

Sequence Viewer

Length: 195 bp
ATGGAGAAAGCTCTTGCTTCAACTTCATCTAGAGACTCCTACAAGCATCTATGGCAAAAGCTATGGAAAAAAAAAGTCCCTGGAAAGGTTTTGAACTGTGTTTGGAGAGCTTGTCAAAACCTACTGCCCATAAGAGCCAAATTAATCTCTAAAGGCTATCAAGGGGATCAGAAATGTGTCTCTTGCTCCCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.35

Weight (kDa)

9.91

Isoelectric Point (pI)

30.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RVT PF13966 8 - 63 3.8e-09 zinc-binding in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 174
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 21, 94
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 3 cut(s) 11, 61, 110
AluI AGCT 3 cut(s) 11, 61, 110
Alw26I GTCTC 2 cut(s) 27, 184
AlwI GGATC 1 cut(s) 174
AseI ATTAAT 1 cut(s) 143
BciT130I CCWGG 1 cut(s) 81
BcoDI GTCTC 2 cut(s) 27, 184
BfaI CTAG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 79
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bsc4I CCNNNNNNNGG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 85
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 85
BsmAI GTCTC 2 cut(s) 27, 184
BsmFI GGGAC 1 cut(s) 62
Bsp143I GATC 1 cut(s) 166
BspPI GGATC 1 cut(s) 174
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 98
BstKTI GATC 1 cut(s) 169
BstMAI GTCTC 2 cut(s) 27, 184
BstMBI GATC 1 cut(s) 166
BstMWI GCNNNNNNNGC 1 cut(s) 52
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
CviJI RGCY 5 cut(s) 11, 61, 110, 137, 156
CviKI_1 RGCY 5 cut(s) 11, 61, 110, 137, 156
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
EcoRII CCWGG 1 cut(s) 79
FaiI YATR 3 cut(s) 52, 64, 131
FaqI GGGAC 1 cut(s) 62
FspBI CTAG 1 cut(s) 30
HinfI GANTC 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
Kzo9I GATC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 191
LpnPI CCDG 2 cut(s) 66, 93
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 30
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MluCI AATT 1 cut(s) 140
MlyI GAGTC 1 cut(s) 29
MseI TTAA 2 cut(s) 143, 193
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
MwoI GCNNNNNNNGC 1 cut(s) 52
NdeII GATC 1 cut(s) 166
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
PshBI ATTAAT 1 cut(s) 143
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
SaqAI TTAA 2 cut(s) 143, 193
Sau3AI GATC 1 cut(s) 166
SchI GAGTC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 81
SetI ASST 5 cut(s) 13, 63, 90, 112, 123
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 7 cut(s) 26, 42, 55, 92, 93, 123, 173
Sse9I AATT 1 cut(s) 140
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 1 cut(s) 98
TasI AATT 1 cut(s) 140
Tru1I TTAA 2 cut(s) 143, 193
Tru9I TTAA 2 cut(s) 143, 193
TspDTI ATGAA 1 cut(s) 15
VspI ATTAAT 1 cut(s) 143
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.