Rorug04G0201600

PsbB mRNA maturation factor Mbb1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
35005887 .. 35006048
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0201600.1

Sequence Viewer

Length: 162 bp
ATGGTTGCAGACTGCCTTGCTAAGGAGAGCATCAATCATGATTATGGGATAATTGAGTTTGATAGCCCTCCCACTCATGCCTCTTCTGCTTACCTTGATGACCTTGATGGTATAACCCGGCAAAGAAGAATCTCTGCCAGGCATGATGATAGGCCAAGCTAG

Protein Analysis

53

Amino Acids

5.96

Weight (kDa)

5.0

Isoelectric Point (pI)

64.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 22
AjnI CCWGG 1 cut(s) 137
AluBI AGCT 1 cut(s) 159
AluI AGCT 1 cut(s) 159
AoxI GGCC 1 cut(s) 152
AsuC2I CCSGG 1 cut(s) 118
BccI CCATC 1 cut(s) 101
BciT130I CCWGG 1 cut(s) 139
BcnI CCSGG 1 cut(s) 118
BfaI CTAG 1 cut(s) 160
Bme1390I CCNGG 2 cut(s) 118, 139
BmrFI CCNGG 2 cut(s) 118, 139
BmsI GCATC 1 cut(s) 39
Bpu10I CCTNAGC 1 cut(s) 21
BpuMI CCSGG 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 22
BseBI CCWGG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 22
BshFI GGCC 1 cut(s) 154
BsiSI CCGG 1 cut(s) 118
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 1 cut(s) 154
BspANI GGCC 1 cut(s) 154
BspHI TCATGA 1 cut(s) 37
Bst2UI CCWGG 1 cut(s) 139
Bst6I CTCTTC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 21
BstENI CCTNNNNNAGG 1 cut(s) 20
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 2 cut(s) 116, 137
BsuRI GGCC 1 cut(s) 154
CciI TCATGA 1 cut(s) 37
CviAII CATG 3 cut(s) 38, 77, 143
CviJI RGCY 3 cut(s) 66, 154, 159
CviKI_1 RGCY 3 cut(s) 66, 154, 159
DdeI CTNAG 1 cut(s) 21
Eam1104I CTCTTC 1 cut(s) 88
EarI CTCTTC 1 cut(s) 88
EcoNI CCTNNNNNAGG 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 137
FaeI CATG 3 cut(s) 41, 80, 146
FaiI YATR 5 cut(s) 39, 45, 78, 113, 144
FatI CATG 3 cut(s) 37, 76, 142
FspBI CTAG 1 cut(s) 160
HaeIII GGCC 1 cut(s) 154
HapII CCGG 1 cut(s) 118
Hin1II CATG 3 cut(s) 41, 80, 146
HinfI GANTC 1 cut(s) 129
HpaII CCGG 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 38
HpyCH4V TGCA 1 cut(s) 8
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 3 cut(s) 41, 80, 146
LpnPI CCDG 3 cut(s) 124, 131, 151
LweI GCATC 1 cut(s) 39
MaeI CTAG 1 cut(s) 160
MboII GAAGA 2 cut(s) 75, 138
MluCI AATT 1 cut(s) 51
MnlI CCTC 2 cut(s) 78, 91
MslI CAYNNNNRTG 1 cut(s) 42
MspI CCGG 1 cut(s) 118
MspR9I CCNGG 2 cut(s) 118, 139
MvaI CCWGG 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 86
NciI CCSGG 1 cut(s) 118
NlaIII CATG 3 cut(s) 41, 80, 146
PagI TCATGA 1 cut(s) 37
PfeI GAWTC 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 42
ScrFI CCNGG 2 cut(s) 118, 139
SetI ASST 3 cut(s) 96, 105, 161
SfaNI GCATC 1 cut(s) 39
SmiMI CAYNNNNRTG 1 cut(s) 42
Sse9I AATT 1 cut(s) 51
SspMI CTAG 1 cut(s) 160
StyD4I CCNGG 2 cut(s) 116, 137
TasI AATT 1 cut(s) 51
TfiI GAWTC 1 cut(s) 129
XagI CCTNNNNNAGG 1 cut(s) 20
XspI CTAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.