Rorug04G0278200

Core-2/I-Branching enzyme

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
45087047 .. 45087477
431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0278200.1

Sequence Viewer

Length: 222 bp
ATGTTTAATCTTATATCCCAGACACAAGCTTTGCAGAAGAGCAGATCTGACTTTACTCCGTTTAACTCAGAAGATCAAGATGCAATTGGTTGCAATCGCCTTCATCATCAGGGGTATGGATCAGATTGGCATGAAGAAACATCGGCGATGTCAAAATCGACGCTCACCGCTTTGTTCTTCGAACCCAAATTTCAATCCATGGTTAAATACGATCGGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.47

Weight (kDa)

5.48

Isoelectric Point (pI)

55.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 168
AclWI GGATC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 188
AgsI TTSAA 1 cut(s) 194
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
AlwI GGATC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 188
ArsI GACNNNNNNTTYG 2 cut(s) 13, 45
AsuHPI GGTGA 1 cut(s) 157
AsuII TTCGAA 1 cut(s) 180
BglII AGATCT 1 cut(s) 44
BmsI GCATC 1 cut(s) 70
Bpu14I TTCGAA 1 cut(s) 180
BsaJI CCNNGG 1 cut(s) 198
BseDI CCNNGG 1 cut(s) 198
BseMII CTCAG 1 cut(s) 81
Bsh1285I CGRYCG 1 cut(s) 214
BsiEI CGRYCG 1 cut(s) 214
Bsp119I TTCGAA 1 cut(s) 180
Bsp143I GATC 4 cut(s) 44, 73, 119, 211
Bsp19I CCATGG 1 cut(s) 198
BspACI CCGC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 80
BspPI GGATC 1 cut(s) 127
BspQI GCTCTTC 1 cut(s) 32
BspT104I TTCGAA 1 cut(s) 180
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 4 cut(s) 44, 73, 119, 211
BssT1I CCWWGG 1 cut(s) 198
Bst6I CTCTTC 1 cut(s) 32
BstBI TTCGAA 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 67
BstDSI CCRYGG 1 cut(s) 198
BstKTI GATC 4 cut(s) 47, 76, 122, 214
BstMBI GATC 4 cut(s) 44, 73, 119, 211
BstMCI CGRYCG 1 cut(s) 214
BstX2I RGATCY 1 cut(s) 44
BstYI RGATCY 1 cut(s) 44
BtgI CCRYGG 1 cut(s) 198
BtgZI GCGATG 1 cut(s) 161
CseI GACGC 1 cut(s) 169
CviAII CATG 2 cut(s) 131, 199
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DdeI CTNAG 1 cut(s) 67
DpnI GATC 4 cut(s) 46, 75, 121, 213
DpnII GATC 4 cut(s) 44, 73, 119, 211
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
Eco130I CCWWGG 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 198
ErhI CCWWGG 1 cut(s) 198
FaeI CATG 2 cut(s) 134, 202
FaiI YATR 4 cut(s) 14, 117, 132, 200
FatI CATG 2 cut(s) 130, 198
HgaI GACGC 1 cut(s) 169
Hin1II CATG 2 cut(s) 134, 202
HindIII AAGCTT 1 cut(s) 27
HphI GGTGA 1 cut(s) 157
Hpy188I TCNGA 3 cut(s) 49, 70, 124
Hpy188III TCNNGA 2 cut(s) 77, 215
Hpy99I CGWCG 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 110
HpyCH4V TGCA 3 cut(s) 34, 83, 93
HpyF3I CTNAG 1 cut(s) 67
Hsp92II CATG 2 cut(s) 134, 202
Kzo9I GATC 4 cut(s) 44, 73, 119, 211
LguI GCTCTTC 1 cut(s) 32
LpnPI CCDG 2 cut(s) 32, 95
LweI GCATC 1 cut(s) 70
MalI GATC 4 cut(s) 46, 75, 121, 213
MboI GATC 4 cut(s) 44, 73, 119, 211
MboII GAAGA 4 cut(s) 49, 83, 146, 169
MfeI CAATTG 1 cut(s) 84
MflI RGATCY 1 cut(s) 44
MluCI AATT 2 cut(s) 84, 188
MseI TTAA 3 cut(s) 6, 63, 204
MunI CAATTG 1 cut(s) 84
NcoI CCATGG 1 cut(s) 198
NdeII GATC 4 cut(s) 44, 73, 119, 211
NlaIII CATG 2 cut(s) 134, 202
NspV TTCGAA 1 cut(s) 180
PciSI GCTCTTC 1 cut(s) 32
Ple19I CGATCG 1 cut(s) 214
PsuI RGATCY 1 cut(s) 44
PvuI CGATCG 1 cut(s) 214
SapI GCTCTTC 1 cut(s) 32
SaqAI TTAA 3 cut(s) 6, 63, 204
Sau3AI GATC 4 cut(s) 44, 73, 119, 211
SetI ASST 1 cut(s) 31
SfaNI GCATC 1 cut(s) 70
SfuI TTCGAA 1 cut(s) 180
SgeI CNNG 6 cut(s) 31, 38, 89, 122, 143, 211
Sse9I AATT 2 cut(s) 84, 188
SsiI CCGC 1 cut(s) 168
StyI CCWWGG 1 cut(s) 198
TaqI TCGA 2 cut(s) 158, 180
TasI AATT 2 cut(s) 84, 188
Tru1I TTAA 3 cut(s) 6, 63, 204
Tru9I TTAA 3 cut(s) 6, 63, 204
TspDTI ATGAA 2 cut(s) 92, 147
TspGWI ACGGA 1 cut(s) 48
XapI RAATTY 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.