Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000004

Orthogroup ID

OG0001984

Physical Location & Seq

Genomic Coordinates Forward (+)

46951055 .. 46951417

Gene Structure 363 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug04G0295300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 363 bp

ATGAGATCGGATCGACTAGAGAAGAAGGCTGCTGTTGAATTTGAAAGGGCCAAAGAATTCGCCAGAGCAAAGAATAAAAGCTGTGCTATACAATGTTTGAAGAGGAAGAGGATGTTCAAAAAGCAAATAGAGAAAGTTGGAAATTTCCGATTGCGAATCCATAATCAGATGATGATCCTACAAGGTGAAAAAATGAAGGCAATGCAGAAAGCAATCAACATTGATGACGTGGATAAGACCGTAGATGAGATTAATGAGAAACAGATCCAGGAAGCTTTGTCAACTCCAATTGGTTCAGCTGCTGATTTTGATGATGATGCATTGGTAACAGAACTTGAAGAGTTGGATCGAACATACAATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00440 ko00564 ko00565 ko01100 ko01110 map00440 map00564 map00565 map01100 map01110

Pfam Domains

Protein Families

CDP-OH_P_transf

Protein Analysis

120

Amino Acids

13.95

Weight (kDa)

8.53

Isoelectric Point (pI)

41.55

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Snf7	PF03357	2 - 63	9.8e-08	Snf7
Snf7	PF03357	63 - 116	3.2e-10	Snf7

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001984)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G13560 AT1G13560 AT1G13560 AT3G25585 AT3G25585 AT3G25585 AT3G25585 AT3G25585 AT3G25585
fragaria_vesca	FvH4_4g28600 FvH4_4g28600
malus_domestica	MD12G1007000.v1.1 MD16G1057500.v1.1
prunus_persica	Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.7G262100_v2.0.a1 Prupe.8G087200_v2.0.a1 Prupe.8G087200_v2.0.a1 Prupe.8G087200_v2.0.a1 Prupe.8G087200_v2.0.a1 Prupe.8G087200_v2.0.a1 Prupe.8G087200_v2.0.a1
pyrus_communis	pycom03g00010 pycom12g00510 pycom16g05030
rosa_chinensis	RchiOBHm_Chr4g0436691
rosa_laevigata	RLG00000006503
rosa_multiflora	Rmu_sc0016627.1_g000001
rosa_roxburghii	Rroxscaffold_5G00377770
rosa_rugosa	Rorug04G0295300 Rorug04G0295400
rosa_samantha	Rh4AG349800 Rh4BG358500 Rh4CG372900 Rh4DG352700
rosa_wichuraiana	Rw4G030600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	4 cut(s)	18, 169, 259, 354
AcsI	RAATTY	3 cut(s)	38, 56, 142
AgsI	TTSAA	5 cut(s)	38, 44, 100, 118, 338
AjiI	CACGTC	1 cut(s)	229
AjnI	CCWGG	1 cut(s)	267
AluBI	AGCT	3 cut(s)	81, 275, 299
AluI	AGCT	3 cut(s)	81, 275, 299
AlwI	GGATC	4 cut(s)	18, 169, 259, 354
AlwNI	CAGNNNCTG	1 cut(s)	302
AoxI	GGCC	1 cut(s)	48
ApeKI	GCWGC	2 cut(s)	29, 299
ApoI	RAATTY	3 cut(s)	38, 56, 142
AseI	ATTAAT	1 cut(s)	252
AspS9I	GGNCC	1 cut(s)	48
AsuHPI	GGTGA	1 cut(s)	197
BbvI	GCAGC	2 cut(s)	16, 286
BciT130I	CCWGG	1 cut(s)	269
BfaI	CTAG	1 cut(s)	17
BisI	GCNGC	2 cut(s)	30, 300
BlsI	GCNGC	2 cut(s)	31, 301
Bme1390I	CCNGG	1 cut(s)	269
BmgBI	CACGTC	1 cut(s)	229
BmgT120I	GGNCC	1 cut(s)	48
BmrFI	CCNGG	1 cut(s)	269
BmsI	GCATC	1 cut(s)	307
BsaBI	GATNNNNATC	1 cut(s)	173
Bse3DI	GCAATG	1 cut(s)	207
Bse8I	GATNNNNATC	1 cut(s)	173
BseBI	CCWGG	1 cut(s)	269
BseGI	GGATG	1 cut(s)	117
BseJI	GATNNNNATC	1 cut(s)	173
BseMI	GCAATG	1 cut(s)	207
BseXI	GCAGC	2 cut(s)	16, 286
BshFI	GGCC	1 cut(s)	50
BsnI	GGCC	1 cut(s)	50
Bsp143I	GATC	5 cut(s)	5, 10, 174, 264, 346
BspANI	GGCC	1 cut(s)	50
BspPI	GGATC	4 cut(s)	18, 169, 259, 354
BsrDI	GCAATG	1 cut(s)	207
BssMI	GATC	5 cut(s)	5, 10, 174, 264, 346
Bst2UI	CCWGG	1 cut(s)	269
Bst4CI	ACNGT	1 cut(s)	241
Bst6I	CTCTTC	3 cut(s)	95, 101, 333
BstF5I	GGATG	1 cut(s)	117
BstKTI	GATC	5 cut(s)	8, 13, 177, 267, 349
BstMBI	GATC	5 cut(s)	5, 10, 174, 264, 346
BstNI	CCWGG	1 cut(s)	269
BstSCI	CCNGG	1 cut(s)	267
BstV1I	GCAGC	2 cut(s)	16, 286
BstX2I	RGATCY	1 cut(s)	264
BstYI	RGATCY	1 cut(s)	264
BsuRI	GGCC	1 cut(s)	50
BtrI	CACGTC	1 cut(s)	229
BtsCI	GGATG	1 cut(s)	117
CaiI	CAGNNNCTG	1 cut(s)	302
Cfr13I	GGNCC	1 cut(s)	48
CviJI	RGCY	5 cut(s)	29, 50, 81, 275, 299
CviKI_1	RGCY	5 cut(s)	29, 50, 81, 275, 299
DpnI	GATC	5 cut(s)	7, 12, 176, 266, 348
DpnII	GATC	5 cut(s)	5, 10, 174, 264, 346
Eam1104I	CTCTTC	3 cut(s)	95, 101, 333
EarI	CTCTTC	3 cut(s)	95, 101, 333
EcoRI	GAATTC	1 cut(s)	56
EcoRII	CCWGG	1 cut(s)	267
EcoT22I	ATGCAT	1 cut(s)	322
FaiI	YATR	3 cut(s)	89, 162, 355
Fnu4HI	GCNGC	2 cut(s)	30, 300
FokI	GGATG	1 cut(s)	124
Fsp4HI	GCNGC	2 cut(s)	30, 300
FspBI	CTAG	1 cut(s)	17
GluI	GCNGC	2 cut(s)	30, 300
HaeIII	GGCC	1 cut(s)	50
HincII	GTYRAC	1 cut(s)	282
HindII	GTYRAC	1 cut(s)	282
HindIII	AAGCTT	1 cut(s)	273
HinfI	GANTC	1 cut(s)	156
HphI	GGTGA	1 cut(s)	197
Hpy166II	GTNNAC	1 cut(s)	282
Hpy188I	TCNGA	3 cut(s)	10, 149, 168
Hpy8I	GTNNAC	1 cut(s)	282
HpyAV	CCTTC	2 cut(s)	19, 190
HpyCH4III	ACNGT	1 cut(s)	241
HpyCH4IV	ACGT	1 cut(s)	228
HpyCH4V	TGCA	2 cut(s)	205, 320
HpySE526I	ACGT	1 cut(s)	228
Kzo9I	GATC	5 cut(s)	5, 10, 174, 264, 346
LpnPI	CCDG	3 cut(s)	76, 254, 281
Lsp1109I	GCAGC	2 cut(s)	16, 286
LweI	GCATC	1 cut(s)	307
MaeI	CTAG	1 cut(s)	17
MaeII	ACGT	1 cut(s)	228
MaeIII	GTNAC	1 cut(s)	325
MalI	GATC	5 cut(s)	7, 12, 176, 266, 348
MboI	GATC	5 cut(s)	5, 10, 174, 264, 346
MboII	GAAGA	4 cut(s)	34, 112, 118, 350
MfeI	CAATTG	1 cut(s)	288
MflI	RGATCY	1 cut(s)	264
MluCI	AATT	5 cut(s)	38, 56, 142, 288, 358
MmeI	TCCRAC	2 cut(s)	118, 324
MnlI	CCTC	2 cut(s)	96, 102
Mph1103I	ATGCAT	1 cut(s)	322
MseI	TTAA	1 cut(s)	252
MspA1I	CMGCKG	1 cut(s)	299
MspR9I	CCNGG	1 cut(s)	269
MunI	CAATTG	1 cut(s)	288
MvaI	CCWGG	1 cut(s)	269
NdeII	GATC	5 cut(s)	5, 10, 174, 264, 346
NsiI	ATGCAT	1 cut(s)	322
PfeI	GAWTC	1 cut(s)	156
PfoI	TCCNGGA	1 cut(s)	267
PkrI	GCNGC	2 cut(s)	31, 301
PshBI	ATTAAT	1 cut(s)	252
Psp6I	CCWGG	1 cut(s)	267
PspGI	CCWGG	1 cut(s)	267
PspPI	GGNCC	1 cut(s)	48
PstNI	CAGNNNCTG	1 cut(s)	302
PsuI	RGATCY	1 cut(s)	264
PvuII	CAGCTG	1 cut(s)	299
SaqAI	TTAA	1 cut(s)	252
SatI	GCNGC	2 cut(s)	30, 300
Sau3AI	GATC	5 cut(s)	5, 10, 174, 264, 346
Sau96I	GGNCC	1 cut(s)	48
ScrFI	CCNGG	1 cut(s)	269
SetI	ASST	5 cut(s)	83, 187, 231, 277, 301
SfaNI	GCATC	1 cut(s)	307
SgeI	CNNG	7 cut(s)	29, 75, 194, 241, 280, 281, 347
Sse9I	AATT	5 cut(s)	38, 56, 142, 288, 358
SspMI	CTAG	1 cut(s)	17
StyD4I	CCNGG	1 cut(s)	267
TaaI	ACNGT	1 cut(s)	241
TaiI	ACGT	1 cut(s)	231
TaqI	TCGA	2 cut(s)	13, 349
TasI	AATT	5 cut(s)	38, 56, 142, 288, 358
TfiI	GAWTC	1 cut(s)	156
Tru1I	TTAA	1 cut(s)	252
Tru9I	TTAA	1 cut(s)	252
TseI	GCWGC	2 cut(s)	29, 299
TspDTI	ATGAA	1 cut(s)	209
VspI	ATTAAT	1 cut(s)	252
XapI	RAATTY	3 cut(s)	38, 56, 142
XspI	CTAG	1 cut(s)	17
Zsp2I	ATGCAT	1 cut(s)	322

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.