Rorug05G0167300

DDRGK domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
15534390 .. 15534599
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0167300.1

Sequence Viewer

Length: 210 bp
ATGGTGGAAGGTGAACTACCTCTGAAGGAACTTGACCTCAGTGGAAACCAATTTTCTGGTTCAATTCCACAATCTATCGATAATTTATCATCCTTGGAAACACTAGACATCTCTGGTAATAATTTGACTGAGTCCATTCCTGAAAGTTTGGGACAACTTTCTCAGCTAGTTCACCTAGATCTATTTCAAAATTCTGGGAAGGCAATATAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.38

Weight (kDa)

4.05

Isoelectric Point (pI)

29.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_4 PF12799 8 - 47 1.5e-08 Leucine Rich repeats (2 copies)
LRR_8 PF13855 8 - 64 4.6e-11 Leucine rich repeat
LRR_14 PF23598 8 - 61 4.1e-09 Leucine-rich repeat region
LRR_4 PF12799 31 - 64 4.1e-06 Leucine Rich repeats (2 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 190
AcuI CTGAAG 1 cut(s) 44
AgsI TTSAA 2 cut(s) 63, 188
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
ApoI RAATTY 1 cut(s) 190
AsuHPI GGTGA 2 cut(s) 23, 164
BarI GAAGNNNNNNTAC 1 cut(s) 32
BfaI CTAG 3 cut(s) 104, 167, 176
BglII AGATCT 1 cut(s) 178
Bsa29I ATCGAT 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 93
BseCI ATCGAT 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 89
BseMII CTCAG 3 cut(s) 52, 120, 176
BshVI ATCGAT 1 cut(s) 78
BslFI GGGAC 1 cut(s) 165
BsmFI GGGAC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 178
BspCNI CTCAG 3 cut(s) 51, 121, 175
BspDI ATCGAT 1 cut(s) 78
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 1 cut(s) 178
BssT1I CCWWGG 1 cut(s) 93
BstDEI CTNAG 3 cut(s) 38, 129, 162
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
BstX2I RGATCY 1 cut(s) 178
BstXI CCANNNNNNTGG 1 cut(s) 56
BstYI RGATCY 1 cut(s) 178
Bsu15I ATCGAT 1 cut(s) 78
BsuTUI ATCGAT 1 cut(s) 78
BtsCI GGATG 1 cut(s) 89
BtsIMutI CAGTG 1 cut(s) 46
ClaI ATCGAT 1 cut(s) 78
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
DdeI CTNAG 3 cut(s) 38, 129, 162
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
Eco130I CCWWGG 1 cut(s) 93
Eco57I CTGAAG 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaiI YATR 1 cut(s) 208
FaqI GGGAC 1 cut(s) 165
FokI GGATG 1 cut(s) 76
FspBI CTAG 3 cut(s) 104, 167, 176
HinfI GANTC 1 cut(s) 131
HphI GGTGA 2 cut(s) 23, 164
Hpy166II GTNNAC 2 cut(s) 14, 172
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 2 cut(s) 14, 172
HpyAV CCTTC 2 cut(s) 19, 193
HpyF3I CTNAG 3 cut(s) 38, 129, 162
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 4 cut(s) 42, 99, 153, 180
MaeI CTAG 3 cut(s) 104, 167, 176
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MflI RGATCY 1 cut(s) 178
MluCI AATT 5 cut(s) 50, 63, 82, 121, 190
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 2 cut(s) 30, 47
NdeII GATC 1 cut(s) 178
PflFI GACNNNGTC 1 cut(s) 130
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PsuI RGATCY 1 cut(s) 178
PsyI GACNNNGTC 1 cut(s) 130
Sau3AI GATC 1 cut(s) 178
SchI GAGTC 1 cut(s) 140
SetI ASST 5 cut(s) 13, 22, 39, 168, 177
SgeI CNNG 8 cut(s) 44, 69, 106, 116, 126, 152, 179, 188
Sse9I AATT 5 cut(s) 50, 63, 82, 121, 190
SspMI CTAG 3 cut(s) 104, 167, 176
StyI CCWWGG 1 cut(s) 93
TaqI TCGA 1 cut(s) 78
TasI AATT 5 cut(s) 50, 63, 82, 121, 190
TscAI CASTG 1 cut(s) 46
TspRI CASTG 1 cut(s) 46
Tth111I GACNNNGTC 1 cut(s) 130
XapI RAATTY 1 cut(s) 190
XspI CTAG 3 cut(s) 104, 167, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.