Rorug05G0198500

Cytokinin riboside 5'-monophosphate phosphoribohydrolase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0006355
Physical Location & Seq
Forward (+)
19666421 .. 19666648
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0198500.1

Sequence Viewer

Length: 228 bp
ATGCCATTGCCGCTCTCAGTTGCCAATTTTCTGAATGGTTGTTGTTGGACTTCTTATGCTCTTATTGGAAAAGTGGACTACTTTATTTTGGTTAGCAATGGTCTTGGTGCAATTGCTGGAGCAATATTGCAATTGATAGTCTATGCAATGTACTACAGAACTACATCAAAAGATGAAGACATTTATGACAAGCCTACTAATGAAGTGCAACTTTCAACCATGGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lysine_decarbox

Protein Analysis

75

Amino Acids

8.29

Weight (kDa)

4.53

Isoelectric Point (pI)

24.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MtN3_slv PF03083 1 - 54 5e-09 Sugar efflux transporter for intercellular exchange
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 13
AciI CCGC 1 cut(s) 11
AfaI GTAC 1 cut(s) 152
AgsI TTSAA 1 cut(s) 216
BbsI GAAGAC 1 cut(s) 183
BfmI CTRYAG 1 cut(s) 154
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
BpiI GAAGAC 1 cut(s) 183
BpmI CTGGAG 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 219
Bse3DI GCAATG 3 cut(s) 5, 103, 153
BseDI CCNNGG 1 cut(s) 219
BseMI GCAATG 3 cut(s) 5, 103, 153
BseMII CTCAG 1 cut(s) 30
Bsp19I CCATGG 1 cut(s) 219
BspACI CCGC 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 29
BsrBI CCGCTC 1 cut(s) 13
BsrDI GCAATG 3 cut(s) 5, 103, 153
BssECI CCNNGG 1 cut(s) 219
BssT1I CCWWGG 1 cut(s) 219
BstDEI CTNAG 1 cut(s) 16
BstDSI CCRYGG 1 cut(s) 219
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 154
BstV2I GAAGAC 1 cut(s) 183
BtgI CCRYGG 1 cut(s) 219
Csp6I GTAC 1 cut(s) 151
CviAII CATG 1 cut(s) 220
CviJI RGCY 1 cut(s) 193
CviKI_1 RGCY 1 cut(s) 193
CviQI GTAC 1 cut(s) 151
DdeI CTNAG 1 cut(s) 16
Eco130I CCWWGG 1 cut(s) 219
EcoT14I CCWWGG 1 cut(s) 219
ErhI CCWWGG 1 cut(s) 219
FaeI CATG 1 cut(s) 223
FaiI YATR 4 cut(s) 57, 144, 186, 221
FalI AAGNNNNNCTT 2 cut(s) 195, 227
FatI CATG 1 cut(s) 219
Fnu4HI GCNGC 1 cut(s) 11
Fsp4HI GCNGC 1 cut(s) 11
GluI GCNGC 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 138
Hin1II CATG 1 cut(s) 223
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 33
Hpy8I GTNNAC 1 cut(s) 76
HpyCH4V TGCA 4 cut(s) 110, 130, 146, 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 16
Hsp92II CATG 1 cut(s) 223
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 1 cut(s) 102
MbiI CCGCTC 1 cut(s) 13
MboII GAAGA 1 cut(s) 188
MfeI CAATTG 2 cut(s) 111, 131
MluCI AATT 3 cut(s) 25, 111, 131
MmeI TCCRAC 1 cut(s) 26
MunI CAATTG 2 cut(s) 111, 131
MwoI GCNNNNNNNGC 1 cut(s) 10
NcoI CCATGG 1 cut(s) 219
NlaIII CATG 1 cut(s) 223
PkrI GCNGC 1 cut(s) 12
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SatI GCNGC 1 cut(s) 11
SfcI CTRYAG 1 cut(s) 154
SgeI CNNG 3 cut(s) 116, 129, 202
Sse9I AATT 3 cut(s) 25, 111, 131
SsiI CCGC 1 cut(s) 11
SspI AATATT 1 cut(s) 126
StyI CCWWGG 1 cut(s) 219
TasI AATT 3 cut(s) 25, 111, 131
TatI WGTACW 1 cut(s) 150
TauI GCSGC 1 cut(s) 13
TspDTI ATGAA 2 cut(s) 189, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.