Rorug05G0460300

Transcription elongation factor implicated in the maintenance of proper chromatin structure in actively transcribed regions

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
63373812 .. 63376103
2292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0460300.1

Sequence Viewer

Length: 501 bp
ATGCCCAAGGCTGAGAAGGTTGGTGGGGATTCGAGGGGGTGCTTAGCCTACATTACCGTAGTAATCTGGGAGCACATGGCTGTCAAAACGATTTCGTCAAGTCCATCTATTACTTTCTATTTTGATATTCATGGAGATATGCACAATGATTGGTCAAAGATTACATACACTGGTCATGTCCCAATCAAGGTATCTACAATCGCAACCAAGGTGTCTTTAACAGTGGAAGCACATGATGCAGTTCATGGAGGTACATGTCATGAACAATGTAGGTCTACTTCCATTGGTTCTAAGTCCCTTAAGGAGGAGAATACACTTTGTAAGCCTTGGGCCGGAAACGAGGTGTTGCTAGATGAAAAATTTAAGAAGACCTTAGAAGACATCATCAGCTCTTCGATGCGAAGCATTGTATCTAAACAAGTTGGGCCATCTAAGCAGGCTTTCTACTCTGCCTCATTTGATGGAGATGGAATCGTAAAACAAAATGATAAGTCAATTTAG

Protein Analysis

166

Amino Acids

18.18

Weight (kDa)

7.04

Isoelectric Point (pI)

41.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 275
AcsI RAATTY 1 cut(s) 359
AfaI GTAC 1 cut(s) 253
AfiI CCNNNNNNNGG 3 cut(s) 187, 304, 332
AflII CTTAAG 1 cut(s) 299
AflIII ACRYGT 1 cut(s) 254
AluBI AGCT 1 cut(s) 390
AluI AGCT 1 cut(s) 390
Alw21I GWGCWC 1 cut(s) 75
AoxI GGCC 2 cut(s) 330, 425
ApoI RAATTY 1 cut(s) 359
AspS9I GGNCC 2 cut(s) 330, 425
BarI GAAGNNNNNNTAC 2 cut(s) 262, 294
BbsI GAAGAC 2 cut(s) 374, 384
Bbv12I GWGCWC 1 cut(s) 75
BccI CCATC 4 cut(s) 112, 436, 455, 461
BfaI CTAG 1 cut(s) 350
BfrI CTTAAG 1 cut(s) 299
BlpI GCTNAGC 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 330, 425
BmsI GCATC 2 cut(s) 226, 387
BpiI GAAGAC 2 cut(s) 374, 384
Bpu1102I GCTNAGC 1 cut(s) 43
BsaJI CCNNGG 3 cut(s) 6, 207, 326
Bsc4I CCNNNNNNNGG 3 cut(s) 187, 304, 332
Bse1I ACTGG 1 cut(s) 175
BseDI CCNNGG 3 cut(s) 6, 207, 326
BseLI CCNNNNNNNGG 3 cut(s) 187, 304, 332
BseNI ACTGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 320
BshFI GGCC 2 cut(s) 332, 427
BsiHKAI GWGCWC 1 cut(s) 75
BsiSI CCGG 1 cut(s) 333
BslFI GGGAC 2 cut(s) 164, 280
BslI CCNNNNNNNGG 3 cut(s) 187, 304, 332
BsmFI GGGAC 2 cut(s) 164, 280
BsnI GGCC 2 cut(s) 332, 427
Bsp1286I GDGCHC 1 cut(s) 75
Bsp1720I GCTNAGC 1 cut(s) 43
BspANI GGCC 2 cut(s) 332, 427
BspCNI CTCAG 1 cut(s) 4
BspHI TCATGA 1 cut(s) 259
BspQI GCTCTTC 1 cut(s) 397
BspTI CTTAAG 1 cut(s) 299
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 3 cut(s) 6, 207, 326
BssT1I CCWWGG 3 cut(s) 6, 207, 326
Bst4CI ACNGT 2 cut(s) 58, 223
Bst6I CTCTTC 1 cut(s) 397
BstAFI CTTAAG 1 cut(s) 299
BstAPI GCANNNNNTGC 1 cut(s) 236
BstC8I GCNNGC 1 cut(s) 438
BstDEI CTNAG 5 cut(s) 12, 43, 291, 373, 432
BstENI CCTNNNNNAGG 1 cut(s) 302
BstMWI GCNNNNNNNGC 2 cut(s) 236, 433
BstNSI RCATGY 1 cut(s) 258
BstV2I GAAGAC 2 cut(s) 374, 384
BsuRI GGCC 2 cut(s) 332, 427
BtsIMutI CAGTG 2 cut(s) 168, 228
Cac8I GCNNGC 1 cut(s) 438
CciI TCATGA 1 cut(s) 259
Cfr13I GGNCC 2 cut(s) 330, 425
Csp6I GTAC 1 cut(s) 252
CviAII CATG 7 cut(s) 76, 131, 176, 233, 245, 255, 260
CviJI RGCY 8 cut(s) 11, 47, 80, 325, 332, 390, 427, 440
CviKI_1 RGCY 8 cut(s) 11, 47, 80, 325, 332, 390, 427, 440
CviQI GTAC 1 cut(s) 252
DdeI CTNAG 5 cut(s) 12, 43, 291, 373, 432
Eam1104I CTCTTC 1 cut(s) 397
EarI CTCTTC 1 cut(s) 397
Eco130I CCWWGG 3 cut(s) 6, 207, 326
EcoNI CCTNNNNNAGG 1 cut(s) 302
EcoT14I CCWWGG 3 cut(s) 6, 207, 326
ErhI CCWWGG 3 cut(s) 6, 207, 326
FaeI CATG 7 cut(s) 79, 134, 179, 236, 248, 258, 263
FaiI YATR 9 cut(s) 77, 132, 140, 166, 177, 234, 246, 256, 261
FalI AAGNNNNNCTT 2 cut(s) 356, 388
FaqI GGGAC 2 cut(s) 164, 280
FatI CATG 7 cut(s) 75, 130, 175, 232, 244, 254, 259
FblI GTMKAC 1 cut(s) 275
FspBI CTAG 1 cut(s) 350
HaeIII GGCC 2 cut(s) 332, 427
HapII CCGG 1 cut(s) 333
Hin1II CATG 7 cut(s) 79, 134, 179, 236, 248, 258, 263
HinfI GANTC 2 cut(s) 29, 471
HpaII CCGG 1 cut(s) 333
Hpy166II GTNNAC 1 cut(s) 276
Hpy188III TCNNGA 1 cut(s) 260
Hpy8I GTNNAC 1 cut(s) 276
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 2 cut(s) 58, 223
HpyCH4V TGCA 2 cut(s) 142, 239
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 433
HpyF3I CTNAG 5 cut(s) 12, 43, 291, 373, 432
Hsp92II CATG 7 cut(s) 79, 134, 179, 236, 248, 258, 263
LguI GCTCTTC 1 cut(s) 397
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 52, 156, 346, 422
LweI GCATC 2 cut(s) 226, 387
MaeI CTAG 1 cut(s) 350
MboII GAAGA 3 cut(s) 379, 384, 389
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 2 cut(s) 359, 495
MnlI CCTC 5 cut(s) 27, 242, 298, 334, 463
MseI TTAA 3 cut(s) 218, 300, 363
MspCI CTTAAG 1 cut(s) 299
MspI CCGG 1 cut(s) 333
MwoI GCNNNNNNNGC 2 cut(s) 236, 433
NlaIII CATG 7 cut(s) 79, 134, 179, 236, 248, 258, 263
NspI RCATGY 1 cut(s) 258
PagI TCATGA 1 cut(s) 259
PciI ACATGT 1 cut(s) 254
PciSI GCTCTTC 1 cut(s) 397
PfeI GAWTC 2 cut(s) 29, 471
PscI ACATGT 1 cut(s) 254
PspPI GGNCC 2 cut(s) 330, 425
RsaI GTAC 1 cut(s) 253
RsaNI GTAC 1 cut(s) 252
SapI GCTCTTC 1 cut(s) 397
SaqAI TTAA 3 cut(s) 218, 300, 363
Sau96I GGNCC 2 cut(s) 330, 425
SduI GDGCHC 1 cut(s) 75
SetI ASST 8 cut(s) 21, 192, 213, 253, 275, 345, 374, 392
SfaNI GCATC 2 cut(s) 226, 387
SmlI CTYRAG 1 cut(s) 299
SmoI CTYRAG 1 cut(s) 299
Sse9I AATT 2 cut(s) 359, 495
SspMI CTAG 1 cut(s) 350
StyI CCWWGG 3 cut(s) 6, 207, 326
TaaI ACNGT 2 cut(s) 58, 223
TaqI TCGA 2 cut(s) 32, 395
TasI AATT 2 cut(s) 359, 495
TfiI GAWTC 2 cut(s) 29, 471
Tru1I TTAA 3 cut(s) 218, 300, 363
Tru9I TTAA 3 cut(s) 218, 300, 363
TscAI CASTG 2 cut(s) 175, 228
TspDTI ATGAA 4 cut(s) 119, 233, 276, 369
TspRI CASTG 2 cut(s) 175, 228
Vha464I CTTAAG 1 cut(s) 299
XagI CCTNNNNNAGG 1 cut(s) 302
XapI RAATTY 1 cut(s) 359
XceI RCATGY 1 cut(s) 258
XmiI GTMKAC 1 cut(s) 275
XspI CTAG 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.