Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000005

Orthogroup ID

OG0008704

Physical Location & Seq

Genomic Coordinates Reverse (-)

78786893 .. 78787522

Gene Structure 630 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug05G0589700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

ATGGATATAGCTATATTGGGGTTTTGTCTTGGGGGGAAACTTGGTGCTACAAAAGGATTTGCTGGGAAGGATGTAGTGATTGTGGCGGCCTACCGAACTGCCATTTACAAAGCAAAGCGAGGCGGTTTTAAGGATACTTTAGCTGATGATTTACTGGCACCTGTTTTGAAGGCAGTTATAGAGAGAACAAATTTGAACCCAAGTGAAGTAGGGGATATACTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF719

Protein Analysis

74

Amino Acids

7.77

Weight (kDa)

8.85

Isoelectric Point (pI)

21.52

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Thiolase_N	PF00108	25 - 73	3.5e-09	Thiolase, N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008704)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G15860 AT2G15860 AT2G15860 AT2G15860
fragaria_vesca	FvH4_2g07090 FvH4_2g07090
malus_domestica	MD05G1073700.v1.1 MD10G1088000.v1.1
prunus_persica	Prupe.8G114000_v2.0.a1
pyrus_communis	pycom05g06570 pycom10g07030 pycom10g07040
rosa_chinensis	RchiOBHm_Chr6g0259571 RchiOBHm_Chr6g0259581
rosa_laevigata	RLG00000014521
rosa_multiflora	Rmu_ssc0000050.1_g000018
rosa_roxburghii	Rroxscaffold_7G00206890
rosa_rugosa	Rorug05G0589700
rosa_samantha	Rh6AG105700 Rh6BG099200 Rh6CG094700 Rh6DG088800
rosa_wichuraiana	Rw6G009130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	157
AciI	CCGC	2 cut(s)	86, 123
AcsI	RAATTY	1 cut(s)	190
AgsI	TTSAA	2 cut(s)	169, 196
AluBI	AGCT	2 cut(s)	11, 143
AluI	AGCT	2 cut(s)	11, 143
AoxI	GGCC	1 cut(s)	87
ApoI	RAATTY	1 cut(s)	190
BanI	GGYRCC	1 cut(s)	157
BciVI	GTATCC	1 cut(s)	127
BfmI	CTRYAG	1 cut(s)	221
BfuI	GTATCC	1 cut(s)	127
BisI	GCNGC	1 cut(s)	87
BlsI	GCNGC	1 cut(s)	88
BmiI	GGNNCC	1 cut(s)	159
Bse1I	ACTGG	1 cut(s)	159
BseGI	GGATG	1 cut(s)	76
BseNI	ACTGG	1 cut(s)	159
BseYI	CCCAGC	1 cut(s)	62
BshFI	GGCC	1 cut(s)	89
BshNI	GGYRCC	1 cut(s)	157
BsnI	GGCC	1 cut(s)	89
BspACI	CCGC	2 cut(s)	86, 123
BspANI	GGCC	1 cut(s)	89
BspLI	GGNNCC	1 cut(s)	159
BspT107I	GGYRCC	1 cut(s)	157
BsrI	ACTGG	1 cut(s)	159
BstF5I	GGATG	1 cut(s)	76
BstSFI	CTRYAG	1 cut(s)	221
BsuI	GTATCC	1 cut(s)	127
BsuRI	GGCC	1 cut(s)	89
BtsCI	GGATG	1 cut(s)	76
CviJI	RGCY	3 cut(s)	11, 89, 143
CviKI_1	RGCY	3 cut(s)	11, 89, 143
FaiI	YATR	5 cut(s)	8, 14, 179, 218, 223
Fnu4HI	GCNGC	1 cut(s)	87
FokI	GGATG	1 cut(s)	83
Fsp4HI	GCNGC	1 cut(s)	87
GluI	GCNGC	1 cut(s)	87
GsaI	CCCAGC	1 cut(s)	66
HaeIII	GGCC	1 cut(s)	89
HpyAV	CCTTC	2 cut(s)	61, 163
LpnPI	CCDG	3 cut(s)	48, 140, 174
MluCI	AATT	1 cut(s)	190
MnlI	CCTC	1 cut(s)	113
MseI	TTAA	1 cut(s)	129
NlaIV	GGNNCC	1 cut(s)	159
PkrI	GCNGC	1 cut(s)	88
PspFI	CCCAGC	1 cut(s)	62
PspN4I	GGNNCC	1 cut(s)	159
SaqAI	TTAA	1 cut(s)	129
SatI	GCNGC	1 cut(s)	87
SetI	ASST	3 cut(s)	13, 145, 163
SfcI	CTRYAG	1 cut(s)	221
SgeI	CNNG	7 cut(s)	41, 53, 75, 131, 167, 173, 213
Sse9I	AATT	1 cut(s)	190
SsiI	CCGC	2 cut(s)	86, 123
TasI	AATT	1 cut(s)	190
TauI	GCSGC	1 cut(s)	89
Tru1I	TTAA	1 cut(s)	129
Tru9I	TTAA	1 cut(s)	129
XapI	RAATTY	1 cut(s)	190

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.