Rorug06G0178100

Protein of unknown function (DUF861)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0003853
Physical Location & Seq
Forward (+)
28126371 .. 28126885
515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0178100.1

Sequence Viewer

Length: 414 bp
ATGTGTGATCTTTCCTCTCCAACAGGATTGTATTCTGTAAAATCTGATGTCTTCAGCTTCGGAATACTCTTGCTTGAGATCCTAACGGGAAGAAAGAACATTTTAGGCTTTCATCCCACAAATTCTGCACCAACTCTTCTCAGTTTTACTTGGCAATTATGGAATGAAGGGAAAGTGTTGGAGTTGATGGATCCAATGCTGAAAGATTCATGCAATCCAAATGAGTTCTTGAGATGCATCCGCATTGGATTATTGTGTGTTCAAGAAGACGCAAATAATAGGCCAACCATGTCATCGGTTGTTCTAATGTTAAAGAGTGAAAGTATCAGCCTTTCCAAGCCTGAGCGACCTGCCTTCTTTACAGGAAGATCTATCAATGATCACTGCCATACATGCATTAGGGGATTTACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cupin_3

Protein Analysis

137

Amino Acids

15.36

Weight (kDa)

6.81

Isoelectric Point (pI)

44.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 9 - 102 9e-07 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 358
AciI CCGC 1 cut(s) 241
AclWI GGATC 3 cut(s) 73, 185, 198
AcsI RAATTY 1 cut(s) 121
AcuI CTGAAG 1 cut(s) 37
AgsI TTSAA 1 cut(s) 263
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AlwI GGATC 3 cut(s) 73, 185, 198
AoxI GGCC 1 cut(s) 281
ApoI RAATTY 1 cut(s) 121
BamHI GGATCC 1 cut(s) 190
BbsI GAAGAC 2 cut(s) 43, 273
BccI CCATC 1 cut(s) 181
BclI TGATCA 1 cut(s) 379
BfaI CTAG 1 cut(s) 412
BfuAI ACCTGC 1 cut(s) 358
BglII AGATCT 1 cut(s) 368
BmiI GGNNCC 1 cut(s) 192
BmsI GCATC 2 cut(s) 224, 246
BpiI GAAGAC 2 cut(s) 43, 273
Bpu10I CCTNAGC 1 cut(s) 342
BpuEI CTTGAG 2 cut(s) 95, 250
BseGI GGATG 2 cut(s) 112, 237
BseMII CTCAG 2 cut(s) 154, 333
BsgI GTGCAG 1 cut(s) 111
BshFI GGCC 1 cut(s) 283
BsnI GGCC 1 cut(s) 283
Bsp143I GATC 5 cut(s) 7, 78, 190, 368, 379
BspACI CCGC 1 cut(s) 241
BspANI GGCC 1 cut(s) 283
BspCNI CTCAG 2 cut(s) 153, 334
BspLI GGNNCC 1 cut(s) 192
BspMI ACCTGC 1 cut(s) 358
BspPI GGATC 3 cut(s) 73, 185, 198
BssMI GATC 5 cut(s) 7, 78, 190, 368, 379
Bst6I CTCTTC 1 cut(s) 141
BstDEI CTNAG 2 cut(s) 140, 342
BstF5I GGATG 2 cut(s) 112, 237
BstKTI GATC 5 cut(s) 10, 81, 193, 371, 382
BstMBI GATC 5 cut(s) 7, 78, 190, 368, 379
BstMWI GCNNNNNNNGC 1 cut(s) 393
BstNSI RCATGY 1 cut(s) 396
BstV2I GAAGAC 2 cut(s) 43, 273
BstX2I RGATCY 3 cut(s) 78, 190, 368
BstYI RGATCY 3 cut(s) 78, 190, 368
BsuRI GGCC 1 cut(s) 283
BtsCI GGATG 2 cut(s) 112, 237
BtsI GCAGTG 1 cut(s) 382
BtsIMutI CAGTG 1 cut(s) 382
BveI ACCTGC 1 cut(s) 358
CseI GACGC 1 cut(s) 278
CviAII CATG 3 cut(s) 210, 289, 393
CviJI RGCY 5 cut(s) 57, 108, 283, 330, 340
CviKI_1 RGCY 5 cut(s) 57, 108, 283, 330, 340
DdeI CTNAG 2 cut(s) 140, 342
DpnI GATC 5 cut(s) 9, 80, 192, 370, 381
DpnII GATC 5 cut(s) 7, 78, 190, 368, 379
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco57I CTGAAG 1 cut(s) 37
EcoT22I ATGCAT 2 cut(s) 239, 398
FaeI CATG 3 cut(s) 213, 292, 396
FaiI YATR 5 cut(s) 160, 211, 290, 390, 394
FatI CATG 3 cut(s) 209, 288, 392
FbaI TGATCA 1 cut(s) 379
FokI GGATG 2 cut(s) 99, 224
FspBI CTAG 1 cut(s) 412
HaeIII GGCC 1 cut(s) 283
HgaI GACGC 1 cut(s) 278
Hin1II CATG 3 cut(s) 213, 292, 396
HinfI GANTC 1 cut(s) 206
Hpy188I TCNGA 2 cut(s) 46, 62
Hpy188III TCNNGA 2 cut(s) 229, 263
HpyAV CCTTC 2 cut(s) 161, 364
HpyCH4V TGCA 4 cut(s) 128, 213, 237, 396
HpyF10VI GCNNNNNNNGC 1 cut(s) 393
HpyF3I CTNAG 2 cut(s) 140, 342
Hsp92II CATG 3 cut(s) 213, 292, 396
Ksp22I TGATCA 1 cut(s) 379
Kzo9I GATC 5 cut(s) 7, 78, 190, 368, 379
LpnPI CCDG 4 cut(s) 9, 348, 354, 363
LweI GCATC 2 cut(s) 224, 246
MaeI CTAG 1 cut(s) 412
MalI GATC 5 cut(s) 9, 80, 192, 370, 381
MboI GATC 5 cut(s) 7, 78, 190, 368, 379
MboII GAAGA 5 cut(s) 43, 102, 128, 278, 378
MflI RGATCY 3 cut(s) 78, 190, 368
MluCI AATT 2 cut(s) 121, 155
MmeI TCCRAC 2 cut(s) 44, 159
MnlI CCTC 1 cut(s) 25
Mph1103I ATGCAT 2 cut(s) 239, 398
MseI TTAA 1 cut(s) 311
MwoI GCNNNNNNNGC 1 cut(s) 393
NdeII GATC 5 cut(s) 7, 78, 190, 368, 379
NlaIII CATG 3 cut(s) 213, 292, 396
NlaIV GGNNCC 1 cut(s) 192
NsiI ATGCAT 2 cut(s) 239, 398
NspI RCATGY 1 cut(s) 396
PfeI GAWTC 1 cut(s) 206
PspN4I GGNNCC 1 cut(s) 192
PsuI RGATCY 3 cut(s) 78, 190, 368
SaqAI TTAA 1 cut(s) 311
Sau3AI GATC 5 cut(s) 7, 78, 190, 368, 379
SetI ASST 3 cut(s) 59, 352, 413
SfaNI GCATC 2 cut(s) 224, 246
SmlI CTYRAG 2 cut(s) 74, 229
SmoI CTYRAG 2 cut(s) 74, 229
Sse9I AATT 2 cut(s) 121, 155
SsiI CCGC 1 cut(s) 241
SspMI CTAG 1 cut(s) 412
TasI AATT 2 cut(s) 121, 155
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 311
Tru9I TTAA 1 cut(s) 311
TscAI CASTG 1 cut(s) 389
TspDTI ATGAA 3 cut(s) 101, 180, 198
TspRI CASTG 1 cut(s) 389
XapI RAATTY 1 cut(s) 121
XceI RCATGY 1 cut(s) 396
XspI CTAG 1 cut(s) 412
Zsp2I ATGCAT 2 cut(s) 239, 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.