Rorug06G0248200

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
39489977 .. 39490332
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0248200.1

Sequence Viewer

Length: 246 bp
ATGTATACAAGTGAAAGGACTTTGCCTGAAGAGCAAACTAATCTCCAAGTCTTGTTCAAAACAACCTTAATCACTTATCATCAGAATTACAATTACAGTTCAATGATGATGAACAGAAACGGCATGCTATGGCAGAACTACAGCATTCAGACTGCTCCATCAACATCAAACGGATCAAATTACAATGAACAAAGTATGTCTATGACGTGCGAAAATCATCTACAATTAATACAGAAACATAGATGA

Protein Analysis

81

Amino Acids

9.6

Weight (kDa)

6.81

Isoelectric Point (pI)

50.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 1 cut(s) 181
AcuI CTGAAG 1 cut(s) 48
AgsI TTSAA 2 cut(s) 58, 102
AjiI CACGTC 1 cut(s) 207
AlwI GGATC 1 cut(s) 181
AseI ATTAAT 1 cut(s) 227
BccI CCATC 1 cut(s) 166
BceAI ACGGC 1 cut(s) 136
BfmI CTRYAG 1 cut(s) 139
BmgBI CACGTC 1 cut(s) 207
BsmI GAATGC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 173
BspPI GGATC 1 cut(s) 181
BspQI GCTCTTC 1 cut(s) 24
BssMI GATC 1 cut(s) 173
BssNAI GTATAC 1 cut(s) 6
Bst1107I GTATAC 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 98
Bst6I CTCTTC 1 cut(s) 24
BstC8I GCNNGC 1 cut(s) 125
BstKTI GATC 1 cut(s) 176
BstMBI GATC 1 cut(s) 173
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 127
BstSFI CTRYAG 1 cut(s) 139
BstZ17I GTATAC 1 cut(s) 6
BtrI CACGTC 1 cut(s) 207
Cac8I GCNNGC 1 cut(s) 125
CviAII CATG 1 cut(s) 124
DpnI GATC 1 cut(s) 175
DpnII GATC 1 cut(s) 173
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 48
FaeI CATG 1 cut(s) 127
FaiI YATR 6 cut(s) 6, 125, 130, 197, 203, 240
FatI CATG 1 cut(s) 123
FblI GTMKAC 1 cut(s) 5
FspEI CC 7 cut(s) 39, 59, 79, 105, 115, 156, 171
Hin1II CATG 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 84, 150
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpySE526I ACGT 1 cut(s) 206
Hsp92II CATG 1 cut(s) 127
Kzo9I GATC 1 cut(s) 173
LguI GCTCTTC 1 cut(s) 24
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 1 cut(s) 39
MaeII ACGT 1 cut(s) 206
MalI GATC 1 cut(s) 175
MboI GATC 1 cut(s) 173
MboII GAAGA 1 cut(s) 41
MluCI AATT 4 cut(s) 85, 91, 178, 224
MseI TTAA 2 cut(s) 68, 227
Mva1269I GAATGC 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 1 cut(s) 173
NlaIII CATG 1 cut(s) 127
NspI RCATGY 1 cut(s) 127
PaeI GCATGC 1 cut(s) 127
PciSI GCTCTTC 1 cut(s) 24
PctI GAATGC 1 cut(s) 144
PshBI ATTAAT 1 cut(s) 227
SapI GCTCTTC 1 cut(s) 24
SaqAI TTAA 2 cut(s) 68, 227
Sau3AI GATC 1 cut(s) 173
SetI ASST 2 cut(s) 68, 209
SfcI CTRYAG 1 cut(s) 139
SgeI CNNG 6 cut(s) 21, 38, 59, 64, 136, 219
SphI GCATGC 1 cut(s) 127
Sse9I AATT 4 cut(s) 85, 91, 178, 224
TaaI ACNGT 1 cut(s) 98
TaiI ACGT 1 cut(s) 209
TasI AATT 4 cut(s) 85, 91, 178, 224
Tru1I TTAA 2 cut(s) 68, 227
Tru9I TTAA 2 cut(s) 68, 227
TspDTI ATGAA 2 cut(s) 125, 201
TspGWI ACGGA 1 cut(s) 186
VspI ATTAAT 1 cut(s) 227
XceI RCATGY 1 cut(s) 127
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.