Rh1DG132400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
27573872 .. 27580011
6140 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG132400.1

Sequence Viewer

Length: 198 bp
ATGCTGAATTTAGACATATCATTAAAGGGGAGATTTGAAGAAGGGGCAGAGCAGTTCCGAATAGATGTTGCCCAGAATCCAAATGATACAGAGGAGTCCATTTGGTGCTTTCTCTGTGAAGCTCAATTATATGGAATTAAGGAAGCAAGAGAACGGTTTCTTGAGGTTGGCCGAGATCCAAGACCTGTCATGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.63

Weight (kDa)

4.71

Isoelectric Point (pI)

19.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 170
AcoI YGGCCR 1 cut(s) 169
AcsI RAATTY 1 cut(s) 7
AgsI TTSAA 1 cut(s) 38
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
AlwI GGATC 1 cut(s) 170
AoxI GGCC 1 cut(s) 169
ApoI RAATTY 1 cut(s) 7
Asp700I GAANNNNTTC 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 182
BseRI GAGGAG 1 cut(s) 107
BshFI GGCC 1 cut(s) 171
BsnI GGCC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 175
BspANI GGCC 1 cut(s) 171
BspHI TCATGA 1 cut(s) 189
BspPI GGATC 1 cut(s) 170
BssMI GATC 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 156
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BsuRI GGCC 1 cut(s) 171
CciI TCATGA 1 cut(s) 189
CviAII CATG 1 cut(s) 190
CviJI RGCY 2 cut(s) 122, 171
CviKI_1 RGCY 2 cut(s) 122, 171
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
EaeI YGGCCR 1 cut(s) 169
FaeI CATG 1 cut(s) 193
FaiI YATR 4 cut(s) 17, 130, 132, 191
FatI CATG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 171
Hin1II CATG 1 cut(s) 193
HinfI GANTC 2 cut(s) 76, 95
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 2 cut(s) 161, 190
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 156
Hsp92II CATG 1 cut(s) 193
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 1 cut(s) 86
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MboII GAAGA 1 cut(s) 50
MflI RGATCY 1 cut(s) 175
MluCI AATT 3 cut(s) 7, 125, 135
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 2 cut(s) 85, 157
MroXI GAANNNNTTC 1 cut(s) 156
MseI TTAA 2 cut(s) 23, 138
NdeII GATC 1 cut(s) 175
NlaIII CATG 1 cut(s) 193
NmeAIII GCCGAG 1 cut(s) 197
PagI TCATGA 1 cut(s) 189
PdmI GAANNNNTTC 1 cut(s) 156
PfeI GAWTC 1 cut(s) 76
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
PsuI RGATCY 1 cut(s) 175
SaqAI TTAA 2 cut(s) 23, 138
Sau3AI GATC 1 cut(s) 175
SchI GAGTC 1 cut(s) 104
SetI ASST 3 cut(s) 124, 168, 187
SgeI CNNG 5 cut(s) 85, 159, 173, 185, 192
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 3 cut(s) 7, 125, 135
TaaI ACNGT 1 cut(s) 156
TasI AATT 3 cut(s) 7, 125, 135
TfiI GAWTC 1 cut(s) 76
Tru1I TTAA 2 cut(s) 23, 138
Tru9I TTAA 2 cut(s) 23, 138
XapI RAATTY 1 cut(s) 7
XmnI GAANNNNTTC 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.