Rh2AG087000
ERF Family

Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0008043
Physical Location & Seq
Reverse (-)
7316949 .. 7319129
2181 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG087000.1

Sequence Viewer

Length: 576 bp
ATGGCTTCCCTTCTTACCCCAACCCCAACCGTTGCACTCCAACGCAAGAAAGATCATTTCAGGCTCAACACAAACCCATCATCCAGAATTTCCCAGAAAAATTTTGGGCGCCATGGGGTTTGTTTTGTAACAAAAGCGAAGGTTGGAGGAGATGTACTTGAGAAACAATCAGTTAGTGCTGAGGACAAGAAGGATTATGGACTAGTTAGTCTCCACCATGTTGGAATCTTGTGTCAAAACTTGGAGAGGTCGCTCGACTTTTATCAGAACATTCTTGGTCTTGAAATAAATGAGGCTAGGCCAGATGACAAACTCCCCTATAGGGGGGCTTGGTTATGGGTGGGTTCTGAGATGATTCACCTTATGGAGCTTCCCAATCCTGACCCTCTAACTGGAAGACCTGAGCATGGAGGCCGTGATAGGCACACTTGTGTTGAGATTCGGGATGTGTCTAAGCTGAAAGCAATCCTTGATGAAGCTGGCAAGCTTTTATTTCCTCATCTGAAGTTCATTTCATATGTGACTGATTTTGGAAGGAATGCTGATTGGTTTACTTTGCAATTATCTATACTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyoxalase

Protein Analysis

191

Amino Acids

21.62

Weight (kDa)

8.42

Isoelectric Point (pI)

30.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyoxalase PF00903 71 - 161 1.3e-09 Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 207
AccB1I GGYRCC 1 cut(s) 108
AcsI RAATTY 2 cut(s) 87, 100
AcuI CTGAAG 1 cut(s) 524
AcyI GRCGYC 1 cut(s) 109
AfaI GTAC 1 cut(s) 156
AfiI CCNNNNNNNGG 5 cut(s) 322, 323, 324, 392, 407
AgsI TTSAA 1 cut(s) 284
AhlI ACTAGT 1 cut(s) 202
AleI CACNNNNGTG 1 cut(s) 429
AluBI AGCT 4 cut(s) 370, 457, 479, 487
AluI AGCT 4 cut(s) 370, 457, 479, 487
Alw26I GTCTC 1 cut(s) 215
AoxI GGCC 2 cut(s) 299, 412
ApoI RAATTY 2 cut(s) 87, 100
AspLEI GCGC 1 cut(s) 111
AsuHPI GGTGA 1 cut(s) 350
BanI GGYRCC 1 cut(s) 108
BbsI GAAGAC 1 cut(s) 403
BbvCI CCTCAGC 1 cut(s) 180
BccI CCATC 1 cut(s) 85
BceAI ACGGC 1 cut(s) 399
BcoDI GTCTC 1 cut(s) 215
BcuI ACTAGT 1 cut(s) 202
BfaI CTAG 2 cut(s) 203, 297
BfmI CTRYAG 2 cut(s) 319, 572
BfoI RGCGCY 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 110
BpiI GAAGAC 1 cut(s) 403
Bpu10I CCTNAGC 2 cut(s) 180, 402
BpuEI CTTGAG 1 cut(s) 179
BsaHI GRCGYC 1 cut(s) 109
BsaJI CCNNGG 1 cut(s) 112
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bsc4I CCNNNNNNNGG 5 cut(s) 322, 323, 324, 392, 407
Bse1I ACTGG 1 cut(s) 397
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 2 cut(s) 80, 451
BseLI CCNNNNNNNGG 5 cut(s) 322, 323, 324, 392, 407
BseMII CTCAG 3 cut(s) 171, 339, 393
BseNI ACTGG 1 cut(s) 397
BseRI GAGGAG 1 cut(s) 162
BshFI GGCC 2 cut(s) 301, 414
BshNI GGYRCC 1 cut(s) 108
BslI CCNNNNNNNGG 5 cut(s) 322, 323, 324, 392, 407
BsmAI GTCTC 1 cut(s) 215
BsmI GAATGC 1 cut(s) 544
BsnI GGCC 2 cut(s) 301, 414
Bsp143I GATC 1 cut(s) 52
Bsp19I CCATGG 1 cut(s) 112
BspANI GGCC 2 cut(s) 301, 414
BspCNI CTCAG 3 cut(s) 172, 340, 394
BspLI GGNNCC 1 cut(s) 110
BspT107I GGYRCC 1 cut(s) 108
BsrI ACTGG 1 cut(s) 397
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 1 cut(s) 52
BssNI GRCGYC 1 cut(s) 109
BssT1I CCWWGG 1 cut(s) 112
Bst4CI ACNGT 2 cut(s) 31, 573
BstACI GRCGYC 1 cut(s) 109
BstC8I GCNNGC 2 cut(s) 481, 485
BstDEI CTNAG 4 cut(s) 180, 348, 402, 453
BstDSI CCRYGG 1 cut(s) 112
BstF5I GGATG 2 cut(s) 80, 451
BstH2I RGCGCY 1 cut(s) 112
BstHHI GCGC 1 cut(s) 111
BstKTI GATC 1 cut(s) 55
BstMAI GTCTC 1 cut(s) 215
BstMBI GATC 1 cut(s) 52
BstSFI CTRYAG 2 cut(s) 319, 572
BstV2I GAAGAC 1 cut(s) 403
BstXI CCANNNNNNTGG 1 cut(s) 221
BsuRI GGCC 2 cut(s) 301, 414
BtgI CCRYGG 1 cut(s) 112
BtsCI GGATG 2 cut(s) 80, 451
Cac8I GCNNGC 2 cut(s) 481, 485
CfoI GCGC 1 cut(s) 111
Csp6I GTAC 1 cut(s) 155
CviAII CATG 3 cut(s) 113, 218, 407
CviQI GTAC 1 cut(s) 155
DdeI CTNAG 4 cut(s) 180, 348, 402, 453
DinI GGCGCC 1 cut(s) 110
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
DrdI GACNNNNNNGTC 1 cut(s) 207
DseDI GACNNNNNNGTC 1 cut(s) 207
Eco130I CCWWGG 1 cut(s) 112
Eco57I CTGAAG 1 cut(s) 524
EcoT14I CCWWGG 1 cut(s) 112
EgeI GGCGCC 1 cut(s) 110
EheI GGCGCC 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 112
FaeI CATG 3 cut(s) 116, 221, 410
FalI AAGNNNNNCTT 2 cut(s) 453, 485
FatI CATG 3 cut(s) 112, 217, 406
FauNDI CATATG 1 cut(s) 517
FokI GGATG 2 cut(s) 67, 458
FspBI CTAG 2 cut(s) 203, 297
GlaI GCGC 1 cut(s) 110
HaeII RGCGCY 1 cut(s) 112
HaeIII GGCC 2 cut(s) 301, 414
HhaI GCGC 1 cut(s) 111
Hin1I GRCGYC 1 cut(s) 109
Hin1II CATG 3 cut(s) 116, 221, 410
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 485
HinfI GANTC 3 cut(s) 225, 355, 439
HphI GGTGA 1 cut(s) 350
Hpy166II GTNNAC 1 cut(s) 552
Hpy188I TCNGA 3 cut(s) 267, 349, 504
Hpy188III TCNNGA 4 cut(s) 84, 281, 380, 443
Hpy8I GTNNAC 1 cut(s) 552
HpyAV CCTTC 4 cut(s) 20, 133, 184, 528
HpyCH4III ACNGT 2 cut(s) 31, 573
HpyCH4V TGCA 2 cut(s) 35, 559
HpyF3I CTNAG 4 cut(s) 180, 348, 402, 453
Hsp92I GRCGYC 1 cut(s) 109
Hsp92II CATG 3 cut(s) 116, 221, 410
HspAI GCGC 1 cut(s) 109
KasI GGCGCC 1 cut(s) 108
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 367
LpnPI CCDG 8 cut(s) 46, 97, 107, 315, 378, 393, 414, 465
MaeI CTAG 2 cut(s) 203, 297
MaeIII GTNAC 2 cut(s) 127, 520
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 1 cut(s) 408
MluCI AATT 3 cut(s) 87, 100, 560
Mly113I GGCGCC 1 cut(s) 109
MmeI TCCRAC 3 cut(s) 64, 124, 202
MnlI CCTC 7 cut(s) 140, 175, 240, 286, 396, 404, 507
MslI CAYNNNNRTG 1 cut(s) 429
Mva1269I GAATGC 1 cut(s) 544
NarI GGCGCC 1 cut(s) 109
NcoI CCATGG 1 cut(s) 112
NdeI CATATG 1 cut(s) 517
NdeII GATC 1 cut(s) 52
NlaIII CATG 3 cut(s) 116, 221, 410
NlaIV GGNNCC 1 cut(s) 110
NmuCI GTSAC 1 cut(s) 520
OliI CACNNNNGTG 1 cut(s) 429
PctI GAATGC 1 cut(s) 544
PfeI GAWTC 3 cut(s) 225, 355, 439
PluTI GGCGCC 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 110
RsaI GTAC 1 cut(s) 156
RsaNI GTAC 1 cut(s) 155
RseI CAYNNNNRTG 1 cut(s) 429
Sau3AI GATC 1 cut(s) 52
SetI ASST 8 cut(s) 144, 251, 363, 372, 403, 459, 481, 489
SfcI CTRYAG 2 cut(s) 319, 572
SfoI GGCGCC 1 cut(s) 110
SmiMI CAYNNNNRTG 1 cut(s) 429
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SpeI ACTAGT 1 cut(s) 202
Sse9I AATT 3 cut(s) 87, 100, 560
SspDI GGCGCC 1 cut(s) 108
SspMI CTAG 2 cut(s) 203, 297
StyI CCWWGG 1 cut(s) 112
TaaI ACNGT 2 cut(s) 31, 573
TaqI TCGA 1 cut(s) 255
TasI AATT 3 cut(s) 87, 100, 560
TatI WGTACW 1 cut(s) 154
TfiI GAWTC 3 cut(s) 225, 355, 439
TseFI GTSAC 1 cut(s) 520
Tsp45I GTSAC 1 cut(s) 520
TspDTI ATGAA 3 cut(s) 489, 499, 504
XapI RAATTY 2 cut(s) 87, 100
XcmI CCANNNNNNNNNTGG 1 cut(s) 101
XspI CTAG 2 cut(s) 203, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.