Rh3AG325600

domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0004426
Physical Location & Seq
Reverse (-)
46105159 .. 46110073
4915 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG325600.1

Sequence Viewer

Length: 180 bp
ATGAAGCTCCACATGTGTAATCCATTTCGTCACATTATTCCTCTTCCTTCAAATTACTCCAATCAAATTACATCTTCCTCCGGAGCTCGTAGCTTATTGGTTGGAAGCTCCCACTTAGACCCTAACGAATCACACAAGAGATTAAGTACACAAATACTAGCTAGTCAGTCAGATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRAL_TRIO

Protein Analysis

59

Amino Acids

6.5

Weight (kDa)

9.19

Isoelectric Point (pI)

63.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 80
AfaI GTAC 1 cut(s) 148
AflIII ACRYGT 1 cut(s) 12
AgsI TTSAA 1 cut(s) 51
AluBI AGCT 5 cut(s) 7, 86, 93, 108, 161
AluI AGCT 5 cut(s) 7, 86, 93, 108, 161
Alw21I GWGCWC 1 cut(s) 88
Aor13HI TCCGGA 1 cut(s) 80
BanII GRGCYC 1 cut(s) 88
Bbv12I GWGCWC 1 cut(s) 88
BfaI CTAG 2 cut(s) 158, 162
BsaWI WCCGGW 1 cut(s) 80
BseAI TCCGGA 1 cut(s) 80
BsiHKAI GWGCWC 1 cut(s) 88
BsiSI CCGG 1 cut(s) 81
Bsp1286I GDGCHC 1 cut(s) 88
Bsp13I TCCGGA 1 cut(s) 80
BspEI TCCGGA 1 cut(s) 80
Bst6I CTCTTC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 16
Csp6I GTAC 1 cut(s) 147
CviAII CATG 2 cut(s) 13, 177
CviJI RGCY 5 cut(s) 7, 86, 93, 108, 161
CviKI_1 RGCY 5 cut(s) 7, 86, 93, 108, 161
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 1 cut(s) 115
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Ecl136II GAGCTC 1 cut(s) 86
Eco24I GRGCYC 1 cut(s) 88
Eco53kI GAGCTC 1 cut(s) 86
EcoICRI GAGCTC 1 cut(s) 86
EcoT38I GRGCYC 1 cut(s) 88
FaeI CATG 2 cut(s) 16, 180
FaiI YATR 2 cut(s) 14, 178
FatI CATG 2 cut(s) 12, 176
FriOI GRGCYC 1 cut(s) 88
FspBI CTAG 2 cut(s) 158, 162
HapII CCGG 1 cut(s) 81
Hin1II CATG 2 cut(s) 16, 180
HinfI GANTC 1 cut(s) 128
HpaII CCGG 1 cut(s) 81
Hpy166II GTNNAC 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 1 cut(s) 81
Hpy8I GTNNAC 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 115
Hsp92II CATG 2 cut(s) 16, 180
Kpn2I TCCGGA 1 cut(s) 80
LmnI GCTCC 3 cut(s) 12, 83, 113
LpnPI CCDG 1 cut(s) 94
MaeI CTAG 2 cut(s) 158, 162
MaeIII GTNAC 1 cut(s) 29
MboII GAAGA 2 cut(s) 35, 66
MhlI GDGCHC 1 cut(s) 88
MluCI AATT 2 cut(s) 52, 66
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 2 cut(s) 51, 88
MroI TCCGGA 1 cut(s) 80
MseI TTAA 1 cut(s) 143
MspI CCGG 1 cut(s) 81
NlaIII CATG 2 cut(s) 16, 180
NmuCI GTSAC 1 cut(s) 29
NspI RCATGY 1 cut(s) 16
PciI ACATGT 1 cut(s) 12
PfeI GAWTC 1 cut(s) 128
PscI ACATGT 1 cut(s) 12
Psp124BI GAGCTC 1 cut(s) 88
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
SacI GAGCTC 1 cut(s) 88
SaqAI TTAA 1 cut(s) 143
SduI GDGCHC 1 cut(s) 88
SetI ASST 5 cut(s) 9, 88, 95, 110, 163
SgeI CNNG 6 cut(s) 25, 93, 99, 148, 170, 174
Sse9I AATT 2 cut(s) 52, 66
SspMI CTAG 2 cut(s) 158, 162
SstI GAGCTC 1 cut(s) 88
TasI AATT 2 cut(s) 52, 66
TatI WGTACW 1 cut(s) 146
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TseFI GTSAC 1 cut(s) 29
Tsp45I GTSAC 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 16
XspI CTAG 2 cut(s) 158, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.