Rh3DG334700

Transcription initiation factor TFIID subunit 8-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
37302271 .. 37304168
1898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG334700.1

Sequence Viewer

Length: 240 bp
ATGCCTCCAAAATCAAAACCCCAGCAGTGCAAAACTCCAAAACTAGTCATAATTCCCACACCGGAAAACCCAACCCCGTCGGAGTTCTCCACCGCCATATCCAGAACCACCGTCGCCCAGATCTCCGCCCTCGAAACCCTAACCCACGTCGCTATCGACTACCTCGTGGCTATAGCCAAGTCCTCAGCCTCCTATAGCTTACTGAATTTGGTTTCTCCGAAGGACGAAAGAAGCAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.5

Weight (kDa)

8.89

Isoelectric Point (pI)

44.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 93, 126
AcsI RAATTY 1 cut(s) 205
AhlI ACTAGT 1 cut(s) 43
AjiI CACGTC 1 cut(s) 148
AluBI AGCT 1 cut(s) 198
AluI AGCT 1 cut(s) 198
ApoI RAATTY 1 cut(s) 205
BauI CACGAG 1 cut(s) 164
BbvCI CCTCAGC 1 cut(s) 184
BcuI ACTAGT 1 cut(s) 43
BfaI CTAG 1 cut(s) 44
BfmI CTRYAG 2 cut(s) 171, 193
BglII AGATCT 1 cut(s) 120
BmgBI CACGTC 1 cut(s) 148
Bpu10I CCTNAGC 1 cut(s) 184
BsaWI WCCGGW 1 cut(s) 61
BseMII CTCAG 1 cut(s) 198
BseYI CCCAGC 1 cut(s) 21
BsiSI CCGG 1 cut(s) 62
Bsp143I GATC 1 cut(s) 120
BspACI CCGC 2 cut(s) 93, 126
BspCNI CTCAG 1 cut(s) 197
BssMI GATC 1 cut(s) 120
BssSI CACGAG 1 cut(s) 164
Bst2BI CACGAG 1 cut(s) 164
Bst4CI ACNGT 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 184
BstKTI GATC 1 cut(s) 123
BstMBI GATC 1 cut(s) 120
BstSFI CTRYAG 2 cut(s) 171, 193
BstX2I RGATCY 1 cut(s) 120
BstYI RGATCY 1 cut(s) 120
BtrI CACGTC 1 cut(s) 148
BtsI GCAGTG 1 cut(s) 32
BtsIMutI CAGTG 1 cut(s) 32
CviJI RGCY 4 cut(s) 170, 176, 188, 198
CviKI_1 RGCY 4 cut(s) 170, 176, 188, 198
DdeI CTNAG 1 cut(s) 184
DpnI GATC 1 cut(s) 122
DpnII GATC 1 cut(s) 120
EciI GGCGGA 1 cut(s) 115
FaiI YATR 4 cut(s) 50, 98, 173, 195
FspBI CTAG 1 cut(s) 44
GsaI CCCAGC 1 cut(s) 25
HapII CCGG 1 cut(s) 62
HpaII CCGG 1 cut(s) 62
Hpy188I TCNGA 2 cut(s) 82, 219
Hpy188III TCNNGA 1 cut(s) 102
Hpy99I CGWCG 3 cut(s) 82, 116, 152
HpyAV CCTTC 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 1 cut(s) 30
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 147
Kzo9I GATC 1 cut(s) 120
LpnPI CCDG 4 cut(s) 35, 75, 115, 131
MaeI CTAG 1 cut(s) 44
MaeII ACGT 1 cut(s) 147
MalI GATC 1 cut(s) 122
MboI GATC 1 cut(s) 120
MflI RGATCY 1 cut(s) 120
MluCI AATT 2 cut(s) 51, 205
MmeI TCCRAC 1 cut(s) 60
MnlI CCTC 5 cut(s) 15, 140, 173, 193, 199
MseI TTAA 1 cut(s) 238
MspI CCGG 1 cut(s) 62
NdeII GATC 1 cut(s) 120
PcsI WCGNNNNNNNCGW 2 cut(s) 153, 162
PspFI CCCAGC 1 cut(s) 21
PsuI RGATCY 1 cut(s) 120
SaqAI TTAA 1 cut(s) 238
Sau3AI GATC 1 cut(s) 120
SetI ASST 3 cut(s) 150, 165, 200
SfcI CTRYAG 2 cut(s) 171, 193
SpeI ACTAGT 1 cut(s) 43
Sse9I AATT 2 cut(s) 51, 205
SsiI CCGC 2 cut(s) 93, 126
SspMI CTAG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 112
TaiI ACGT 1 cut(s) 150
TaqI TCGA 2 cut(s) 132, 156
TasI AATT 2 cut(s) 51, 205
Tru1I TTAA 1 cut(s) 238
Tru9I TTAA 1 cut(s) 238
TscAI CASTG 1 cut(s) 32
TspRI CASTG 1 cut(s) 32
XapI RAATTY 1 cut(s) 205
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.