Rh4BG171700

UDP-glucoronosyl and UDP-glucosyl transferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
30689582 .. 30693048
3467 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG171700.1

Sequence Viewer

Length: 174 bp
ATGGAGTCGGAGGAAGGGAAAAGTCTAAGAGAAAGGTGTCAAGCTGTCAAGGAAATGGGTTTGGCTGCTTGGAGAAATGGTGGCTCATCCTTCACTCAGAGCTGTGGGATGCCTGCTGCATTTTCTGCAATATTTAATGGACCTGATTCTGCGTTATGTTCAATAGTAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.03

Weight (kDa)

5.11

Isoelectric Point (pI)

48.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 162
AluBI AGCT 2 cut(s) 44, 102
AluI AGCT 2 cut(s) 44, 102
ApeKI GCWGC 2 cut(s) 65, 116
AspS9I GGNCC 1 cut(s) 140
AvaII GGWCC 1 cut(s) 140
BbvI GCAGC 2 cut(s) 52, 103
BisI GCNGC 2 cut(s) 66, 117
BlsI GCNGC 2 cut(s) 67, 118
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
BmsI GCATC 1 cut(s) 99
BsaXI ACNNNNNCTCC 2 cut(s) 64, 94
BseGI GGATG 2 cut(s) 86, 114
BseMII CTCAG 1 cut(s) 110
BseXI GCAGC 2 cut(s) 52, 103
BspCNI CTCAG 1 cut(s) 109
BstAPI GCANNNNNTGC 1 cut(s) 125
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 2 cut(s) 26, 96
BstF5I GGATG 2 cut(s) 86, 114
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstV1I GCAGC 2 cut(s) 52, 103
BtsCI GGATG 2 cut(s) 86, 114
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 140
CviJI RGCY 4 cut(s) 44, 65, 84, 102
CviKI_1 RGCY 4 cut(s) 44, 65, 84, 102
DdeI CTNAG 2 cut(s) 26, 96
Eco47I GGWCC 1 cut(s) 140
FaiI YATR 1 cut(s) 157
Fnu4HI GCNGC 2 cut(s) 66, 117
FokI GGATG 2 cut(s) 73, 121
Fsp4HI GCNGC 2 cut(s) 66, 117
GluI GCNGC 2 cut(s) 66, 117
HinfI GANTC 2 cut(s) 5, 146
Hpy188I TCNGA 2 cut(s) 10, 99
HpyAV CCTTC 2 cut(s) 8, 100
HpyCH4V TGCA 2 cut(s) 119, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 2 cut(s) 26, 96
LpnPI CCDG 2 cut(s) 126, 156
Lsp1109I GCAGC 2 cut(s) 52, 103
LweI GCATC 1 cut(s) 99
MluCI AATT 1 cut(s) 169
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 1 cut(s) 4
MseI TTAA 2 cut(s) 135, 172
MwoI GCNNNNNNNGC 1 cut(s) 125
PfeI GAWTC 1 cut(s) 146
PkrI GCNGC 2 cut(s) 67, 118
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
PspPI GGNCC 1 cut(s) 140
SaqAI TTAA 2 cut(s) 135, 172
SatI GCNGC 2 cut(s) 66, 117
Sau96I GGNCC 1 cut(s) 140
SchI GAGTC 1 cut(s) 14
SetI ASST 4 cut(s) 38, 46, 104, 145
SfaNI GCATC 1 cut(s) 99
SgeI CNNG 5 cut(s) 53, 61, 81, 125, 155
SinI GGWCC 1 cut(s) 140
Sse9I AATT 1 cut(s) 169
SspI AATATT 1 cut(s) 132
TasI AATT 1 cut(s) 169
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 135, 172
Tru9I TTAA 2 cut(s) 135, 172
TseI GCWGC 2 cut(s) 65, 116
VpaK11BI GGWCC 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.