Rh5AG000700
MYB Family

MYB-CC type transfactor, LHEQLE motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
133017 .. 136816
3800 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG000700.1

Sequence Viewer

Length: 729 bp
ATGCGAACAATGAATGTCAAGGGGCTGACACTTTTTCATTTAAAGAGTCATCTACAGAAATACAGGCTAGGTAAGCAAGCAGGAAAGGATATGGATGAGGTATCCAAGGATGCTTCATACCTTCTAGAAAGCCCTGGTACTGGTAATTCTTCGCCAAATTTGGCTACTTCTGATATGAATGAGGGTTATGAAGTCAAAGAGGCATTACGAGTGCAAATGGAAGTACAAAGTAAACTACATGTGCAAGTTGAGGCTGAGAAGCACTTGCAGATTCGCCAGGATGCAGAGCGAAGATATATGGCCATGCTTGAGAGAGCTTGTAAGATGCTTGCCGATCAATTTATTGGAGGTTCAGTCATTGATACTGATGGCCATAAATATCATGGCTTGGGGAATAAGAATCCAAAAAGTTCCTCCCTCGACCCACTTGGCTTCTACTCACTACAATCCACAGATGTGGCTGGAGTTCATGGTCCAGAAGAAGAAGTGCTAACTAGTGTCCATCCCCAAAGGGCTGATTGCTCCACTGAAAGCTGCCTCACATCACATGAGAGTCCTGGAGGACTAACTTTGGAAGGATCTCCAGGTGGTGGGAAAAAAAGAATGTTGAGCTTGGAGTCGGCAACTGCATCTCTAATTTGGGGTGAAGCCAAGGTGAGAACCCAAGAGATTAATCTAGCCCCAGTTGAGCCTCATGGAATTACAAGGCTTGAAAACCATAGGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

242

Amino Acids

26.58

Weight (kDa)

6.26

Isoelectric Point (pI)

49.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_CC_LHEQLE PF14379 64 - 109 2.4e-16 MYB-CC type transfactor, LHEQLE motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 590
AclWI GGATC 1 cut(s) 586
AcoI YGGCCR 2 cut(s) 300, 370
AcsI RAATTY 1 cut(s) 157
AfaI GTAC 2 cut(s) 139, 225
AfiI CCNNNNNNNGG 2 cut(s) 140, 590
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 1 cut(s) 713
AhlI ACTAGT 1 cut(s) 494
AjnI CCWGG 4 cut(s) 133, 276, 556, 583
AleI CACNNNNGTG 1 cut(s) 455
AluBI AGCT 3 cut(s) 317, 534, 612
AluI AGCT 3 cut(s) 317, 534, 612
AlwI GGATC 1 cut(s) 586
AoxI GGCC 2 cut(s) 300, 370
ApeKI GCWGC 1 cut(s) 534
ApoI RAATTY 1 cut(s) 157
AseI ATTAAT 1 cut(s) 672
AspS9I GGNCC 1 cut(s) 473
AsuHPI GGTGA 2 cut(s) 656, 667
AvaII GGWCC 1 cut(s) 473
BalI TGGCCA 2 cut(s) 302, 372
BbvI GCAGC 1 cut(s) 521
BccI CCATC 2 cut(s) 362, 510
BciT130I CCWGG 4 cut(s) 135, 278, 558, 585
BciVI GTATCC 1 cut(s) 112
BcuI ACTAGT 1 cut(s) 494
BfaI CTAG 4 cut(s) 68, 125, 495, 677
BfmI CTRYAG 1 cut(s) 53
BfuI GTATCC 1 cut(s) 112
BisI GCNGC 1 cut(s) 535
BlsI GCNGC 1 cut(s) 536
Bme1390I CCNGG 4 cut(s) 135, 278, 558, 585
Bme18I GGWCC 1 cut(s) 473
BmgT120I GGNCC 1 cut(s) 473
BmrFI CCNGG 4 cut(s) 135, 278, 558, 585
BmrI ACTGGG 1 cut(s) 677
BmsI GCATC 4 cut(s) 100, 271, 315, 638
BmuI ACTGGG 1 cut(s) 677
BpmI CTGGAG 3 cut(s) 483, 567, 579
BpuEI CTTGAG 1 cut(s) 329
BsaJI CCNNGG 3 cut(s) 105, 133, 651
BsaXI ACNNNNNCTCC 2 cut(s) 339, 369
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 590
Bse1I ACTGG 2 cut(s) 145, 683
BseBI CCWGG 4 cut(s) 135, 278, 558, 585
BseDI CCNNGG 3 cut(s) 105, 133, 651
BseGI GGATG 4 cut(s) 100, 115, 286, 502
BseLI CCNNNNNNNGG 2 cut(s) 140, 590
BseMII CTCAG 1 cut(s) 246
BseNI ACTGG 2 cut(s) 145, 683
BseXI GCAGC 1 cut(s) 521
BshFI GGCC 2 cut(s) 302, 372
BslI CCNNNNNNNGG 2 cut(s) 140, 590
BsnI GGCC 2 cut(s) 302, 372
Bsp143I GATC 2 cut(s) 334, 578
BspANI GGCC 2 cut(s) 302, 372
BspCNI CTCAG 1 cut(s) 247
BspPI GGATC 1 cut(s) 586
BsrI ACTGG 2 cut(s) 145, 683
BssECI CCNNGG 3 cut(s) 105, 133, 651
BssMI GATC 2 cut(s) 334, 578
BssT1I CCWWGG 2 cut(s) 105, 651
Bst2UI CCWGG 4 cut(s) 135, 278, 558, 585
BstC8I GCNNGC 2 cut(s) 78, 330
BstDEI CTNAG 1 cut(s) 255
BstF5I GGATG 4 cut(s) 100, 115, 286, 502
BstKTI GATC 2 cut(s) 337, 581
BstMBI GATC 2 cut(s) 334, 578
BstMWI GCNNNNNNNGC 1 cut(s) 73
BstNI CCWGG 4 cut(s) 135, 278, 558, 585
BstNSI RCATGY 1 cut(s) 242
BstSCI CCNGG 4 cut(s) 133, 276, 556, 583
BstSFI CTRYAG 1 cut(s) 53
BstV1I GCAGC 1 cut(s) 521
BstX2I RGATCY 1 cut(s) 578
BstXI CCANNNNNNTGG 1 cut(s) 457
BstYI RGATCY 1 cut(s) 578
BsuI GTATCC 1 cut(s) 112
BsuRI GGCC 2 cut(s) 302, 372
BtsCI GGATG 4 cut(s) 100, 115, 286, 502
BtsIMutI CAGTG 1 cut(s) 525
Cac8I GCNNGC 2 cut(s) 78, 330
Cfr13I GGNCC 1 cut(s) 473
Csp6I GTAC 2 cut(s) 138, 224
CviAII CATG 6 cut(s) 239, 304, 383, 470, 548, 695
CviQI GTAC 2 cut(s) 138, 224
DdeI CTNAG 1 cut(s) 255
DpnI GATC 2 cut(s) 336, 580
DpnII GATC 2 cut(s) 334, 578
DraI TTTAAA 1 cut(s) 42
EaeI YGGCCR 2 cut(s) 300, 370
Eco130I CCWWGG 2 cut(s) 105, 651
Eco47I GGWCC 1 cut(s) 473
EcoRII CCWGG 4 cut(s) 133, 276, 556, 583
EcoT14I CCWWGG 2 cut(s) 105, 651
ErhI CCWWGG 2 cut(s) 105, 651
FaeI CATG 6 cut(s) 242, 307, 386, 473, 551, 698
FatI CATG 6 cut(s) 238, 303, 382, 469, 547, 694
Fnu4HI GCNGC 1 cut(s) 535
FokI GGATG 4 cut(s) 107, 122, 293, 489
Fsp4HI GCNGC 1 cut(s) 535
FspBI CTAG 4 cut(s) 68, 125, 495, 677
GluI GCNGC 1 cut(s) 535
GsuI CTGGAG 3 cut(s) 483, 567, 579
HaeIII GGCC 2 cut(s) 302, 372
Hin1II CATG 6 cut(s) 242, 307, 386, 473, 551, 698
HinfI GANTC 5 cut(s) 46, 271, 400, 553, 617
HphI GGTGA 2 cut(s) 656, 667
Hpy166II GTNNAC 1 cut(s) 233
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 125, 476
Hpy8I GTNNAC 1 cut(s) 233
HpyAV CCTTC 2 cut(s) 131, 569
HpyCH4V TGCA 5 cut(s) 214, 244, 268, 284, 629
HpyF10VI GCNNNNNNNGC 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 255
Hsp92II CATG 6 cut(s) 242, 307, 386, 473, 551, 698
Kzo9I GATC 2 cut(s) 334, 578
LmnI GCTCC 1 cut(s) 527
Lsp1109I GCAGC 1 cut(s) 521
LweI GCATC 4 cut(s) 100, 271, 315, 638
MaeI CTAG 4 cut(s) 68, 125, 495, 677
MalI GATC 2 cut(s) 336, 580
MboI GATC 2 cut(s) 334, 578
MboII GAAGA 4 cut(s) 141, 303, 491, 494
MflI RGATCY 1 cut(s) 578
MlsI TGGCCA 2 cut(s) 302, 372
MluCI AATT 5 cut(s) 145, 157, 338, 636, 699
MluNI TGGCCA 2 cut(s) 302, 372
MlyI GAGTC 3 cut(s) 55, 562, 626
Mox20I TGGCCA 2 cut(s) 302, 372
MscI TGGCCA 2 cut(s) 302, 372
MseI TTAA 2 cut(s) 41, 672
MslI CAYNNNNRTG 1 cut(s) 455
Msp20I TGGCCA 2 cut(s) 302, 372
MspR9I CCNGG 4 cut(s) 135, 278, 558, 585
MvaI CCWGG 4 cut(s) 135, 278, 558, 585
MwoI GCNNNNNNNGC 1 cut(s) 73
NdeII GATC 2 cut(s) 334, 578
NlaIII CATG 6 cut(s) 242, 307, 386, 473, 551, 698
NspI RCATGY 1 cut(s) 242
OliI CACNNNNGTG 1 cut(s) 455
PciI ACATGT 1 cut(s) 238
PfeI GAWTC 2 cut(s) 271, 400
PflMI CCANNNNNTGG 1 cut(s) 590
PfoI TCCNGGA 1 cut(s) 556
PkrI GCNGC 1 cut(s) 536
PleI GAGTC 3 cut(s) 54, 561, 625
PpsI GAGTC 3 cut(s) 54, 561, 625
PscI ACATGT 1 cut(s) 238
PshBI ATTAAT 1 cut(s) 672
Psp6I CCWGG 4 cut(s) 133, 276, 556, 583
PspGI CCWGG 4 cut(s) 133, 276, 556, 583
PspPI GGNCC 1 cut(s) 473
PsuI RGATCY 1 cut(s) 578
RsaI GTAC 2 cut(s) 139, 225
RsaNI GTAC 2 cut(s) 138, 224
RseI CAYNNNNRTG 1 cut(s) 455
SaqAI TTAA 2 cut(s) 41, 672
SatI GCNGC 1 cut(s) 535
Sau3AI GATC 2 cut(s) 334, 578
Sau96I GGNCC 1 cut(s) 473
SchI GAGTC 3 cut(s) 55, 562, 626
ScrFI CCNGG 4 cut(s) 135, 278, 558, 585
SetI ASST 9 cut(s) 73, 102, 123, 319, 352, 536, 589, 614, 657
SfaNI GCATC 4 cut(s) 100, 271, 315, 638
SfcI CTRYAG 1 cut(s) 53
SinI GGWCC 1 cut(s) 473
SmiMI CAYNNNNRTG 1 cut(s) 455
SmlI CTYRAG 1 cut(s) 308
SmoI CTYRAG 1 cut(s) 308
SpeI ACTAGT 1 cut(s) 494
Sse9I AATT 5 cut(s) 145, 157, 338, 636, 699
SspMI CTAG 4 cut(s) 68, 125, 495, 677
StyD4I CCNGG 4 cut(s) 133, 276, 556, 583
StyI CCWWGG 2 cut(s) 105, 651
TaqI TCGA 1 cut(s) 420
TasI AATT 5 cut(s) 145, 157, 338, 636, 699
TatI WGTACW 1 cut(s) 223
TfiI GAWTC 2 cut(s) 271, 400
Tru1I TTAA 2 cut(s) 41, 672
Tru9I TTAA 2 cut(s) 41, 672
TscAI CASTG 1 cut(s) 532
TseI GCWGC 1 cut(s) 534
TspDTI ATGAA 6 cut(s) 26, 26, 105, 191, 204, 458
TspRI CASTG 1 cut(s) 532
Van91I CCANNNNNTGG 1 cut(s) 590
VpaK11BI GGWCC 1 cut(s) 473
VspI ATTAAT 1 cut(s) 672
XapI RAATTY 1 cut(s) 157
XbaI TCTAGA 1 cut(s) 124
XceI RCATGY 1 cut(s) 242
XcmI CCANNNNNNNNNTGG 1 cut(s) 380
XspI CTAG 4 cut(s) 68, 125, 495, 677
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.