Rh5AG153200

zinc transporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0008851
Physical Location & Seq
Forward (+)
16119571 .. 16119888
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG153200.1

Sequence Viewer

Length: 318 bp
ATGCAGGCAAAGTTCAGCCATAAAACAATGGCAGTAATGGTGGGATTCTTTTCCATGACCAGCCCCTGTGGAATAGGTGTGGGCATAGCAATCTCCAACACATACAATGAGAATAGCCCCACTTCACTAGTTGTTGAAGGACTGCTATTATCAGCATCTGCAGGGATTCTCATTTACATGGCACTTGTTGATCTTCTTGCTGCTGATTTCATAAACAACGCCAAATTGATAAGCAATCCCAAGCTCCAACTTGGGGCAAATTTTAGTCTTCTTCTAGGAGCAGGGTTTTTGTCACTCTTGGCCAAGTTGGGAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Zip

Protein Analysis

105

Amino Acids

10.92

Weight (kDa)

6.53

Isoelectric Point (pI)

16.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zip PF02535 2 - 101 2.1e-24 ZIP Zinc transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 300
AcsI RAATTY 1 cut(s) 259
AfiI CCNNNNNNNGG 1 cut(s) 253
AgsI TTSAA 1 cut(s) 137
AhlI ACTAGT 1 cut(s) 127
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
AlwNI CAGNNNCTG 2 cut(s) 66, 158
AoxI GGCC 1 cut(s) 300
ApeKI GCWGC 1 cut(s) 200
ApoI RAATTY 1 cut(s) 259
BalI TGGCCA 1 cut(s) 302
BbsI GAAGAC 1 cut(s) 260
BbvI GCAGC 1 cut(s) 187
BcuI ACTAGT 1 cut(s) 127
BfaI CTAG 2 cut(s) 128, 275
BfmI CTRYAG 1 cut(s) 159
BisI GCNGC 1 cut(s) 201
BlsI GCNGC 1 cut(s) 202
BmsI GCATC 1 cut(s) 164
BpiI GAAGAC 1 cut(s) 260
Bsc4I CCNNNNNNNGG 1 cut(s) 253
BseLI CCNNNNNNNGG 1 cut(s) 253
BseXI GCAGC 1 cut(s) 187
BshFI GGCC 1 cut(s) 302
BslI CCNNNNNNNGG 1 cut(s) 253
BsnI GGCC 1 cut(s) 302
Bsp143I GATC 1 cut(s) 190
BspANI GGCC 1 cut(s) 302
BspMAI CTGCAG 1 cut(s) 163
BssMI GATC 1 cut(s) 190
BstC8I GCNNGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 159
BstV1I GCAGC 1 cut(s) 187
BstV2I GAAGAC 1 cut(s) 260
BsuRI GGCC 1 cut(s) 302
Cac8I GCNNGC 1 cut(s) 6
CaiI CAGNNNCTG 2 cut(s) 66, 158
CviAII CATG 2 cut(s) 55, 178
CviJI RGCY 5 cut(s) 18, 63, 117, 244, 302
CviKI_1 RGCY 5 cut(s) 18, 63, 117, 244, 302
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
EaeI YGGCCR 1 cut(s) 300
FaeI CATG 2 cut(s) 58, 181
FaiI YATR 6 cut(s) 21, 56, 86, 103, 179, 212
FatI CATG 2 cut(s) 54, 177
Fnu4HI GCNGC 1 cut(s) 201
Fsp4HI GCNGC 1 cut(s) 201
FspBI CTAG 2 cut(s) 128, 275
GluI GCNGC 1 cut(s) 201
HaeIII GGCC 1 cut(s) 302
Hin1II CATG 2 cut(s) 58, 181
HinfI GANTC 2 cut(s) 45, 166
HpyAV CCTTC 1 cut(s) 131
HpyCH4V TGCA 2 cut(s) 4, 161
Hsp92II CATG 2 cut(s) 58, 181
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 2 cut(s) 249, 278
LpnPI CCDG 4 cut(s) 73, 79, 147, 267
Lsp1109I GCAGC 1 cut(s) 187
LweI GCATC 1 cut(s) 164
MaeI CTAG 2 cut(s) 128, 275
MaeIII GTNAC 1 cut(s) 291
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 3 cut(s) 185, 260, 263
MlsI TGGCCA 1 cut(s) 302
MluCI AATT 2 cut(s) 224, 259
MluNI TGGCCA 1 cut(s) 302
MmeI TCCRAC 2 cut(s) 120, 271
Mox20I TGGCCA 1 cut(s) 302
MscI TGGCCA 1 cut(s) 302
MslI CAYNNNNRTG 1 cut(s) 176
Msp20I TGGCCA 1 cut(s) 302
NdeII GATC 1 cut(s) 190
NlaIII CATG 2 cut(s) 58, 181
NmuCI GTSAC 1 cut(s) 291
PfeI GAWTC 2 cut(s) 45, 166
PkrI GCNGC 1 cut(s) 202
PstI CTGCAG 1 cut(s) 163
PstNI CAGNNNCTG 2 cut(s) 66, 158
RseI CAYNNNNRTG 1 cut(s) 176
SatI GCNGC 1 cut(s) 201
Sau3AI GATC 1 cut(s) 190
SetI ASST 2 cut(s) 79, 246
SfaNI GCATC 1 cut(s) 164
SfcI CTRYAG 1 cut(s) 159
SmiMI CAYNNNNRTG 1 cut(s) 176
SpeI ACTAGT 1 cut(s) 127
Sse9I AATT 2 cut(s) 224, 259
SspMI CTAG 2 cut(s) 128, 275
TasI AATT 2 cut(s) 224, 259
TfiI GAWTC 2 cut(s) 45, 166
TseFI GTSAC 1 cut(s) 291
TseI GCWGC 1 cut(s) 200
Tsp45I GTSAC 1 cut(s) 291
TspDTI ATGAA 1 cut(s) 199
XapI RAATTY 1 cut(s) 259
XspI CTAG 2 cut(s) 128, 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.