Rh5CG101100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0011070
Physical Location & Seq
Reverse (-)
8104519 .. 8104836
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG101100.1

Sequence Viewer

Length: 318 bp
ATGACCCCACAAGGCTGCAGCCGAGATGATTTAATCCTTCTACGTCCCTCTCCACCCCGAAATCAGCGCACTCTCGATCGCAACCACCACCACGAGTTCTCCGAGCTAAAGGACAAGTGTTGGAAAGTCATTGGCCACATGGGGCGCCACTTCAAGTACAACGAGTTGAGTTACGTGCTCAATTTTTATCAGGAGGACCCCAACTTGGATGACAACAGCTTTCCCCTCAGAATTTTCTCAGATAGGTTGCCGCATTCCCCATTGATCAAGTCTGCTACTGCTTCTCCAACATCCAAGGAGATAACTGTTAGTAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

12.22

Weight (kDa)

7.86

Isoelectric Point (pI)

49.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 144
AciI CCGC 1 cut(s) 251
AcoI YGGCCR 1 cut(s) 133
AcsI RAATTY 1 cut(s) 231
AcyI GRCGYC 1 cut(s) 145
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 205
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 3 cut(s) 106, 219, 315
AluI AGCT 3 cut(s) 106, 219, 315
Alw21I GWGCWC 1 cut(s) 180
AoxI GGCC 1 cut(s) 133
ApeKI GCWGC 2 cut(s) 15, 18
ApoI RAATTY 1 cut(s) 231
AspLEI GCGC 2 cut(s) 69, 147
AspS9I GGNCC 1 cut(s) 196
AvaII GGWCC 1 cut(s) 196
BalI TGGCCA 1 cut(s) 135
BanI GGYRCC 1 cut(s) 144
BauI CACGAG 1 cut(s) 92
Bbv12I GWGCWC 1 cut(s) 180
BbvI GCAGC 2 cut(s) 2, 30
BclI TGATCA 1 cut(s) 264
BfmI CTRYAG 1 cut(s) 16
BfoI RGCGCY 1 cut(s) 148
BisI GCNGC 3 cut(s) 16, 19, 251
BlsI GCNGC 3 cut(s) 17, 20, 252
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 196
BmiI GGNNCC 2 cut(s) 146, 198
BsaAI YACGTR 1 cut(s) 175
BsaHI GRCGYC 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 294
BsaXI ACNNNNNCTCC 4 cut(s) 83, 113, 268, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 205
BseDI CCNNGG 1 cut(s) 294
BseGI GGATG 2 cut(s) 214, 290
BseLI CCNNNNNNNGG 1 cut(s) 205
BseMII CTCAG 2 cut(s) 241, 252
BseXI GCAGC 2 cut(s) 2, 30
Bsh1285I CGRYCG 1 cut(s) 79
BshFI GGCC 1 cut(s) 135
BshNI GGYRCC 1 cut(s) 144
BsiEI CGRYCG 1 cut(s) 79
BsiHKAI GWGCWC 1 cut(s) 180
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 205
BsmFI GGGAC 1 cut(s) 30
BsmI GAATGC 1 cut(s) 253
BsnI GGCC 1 cut(s) 135
Bsp1286I GDGCHC 1 cut(s) 180
Bsp143I GATC 2 cut(s) 76, 264
BspACI CCGC 1 cut(s) 251
BspANI GGCC 1 cut(s) 135
BspCNI CTCAG 2 cut(s) 240, 251
BspLI GGNNCC 2 cut(s) 146, 198
BspMAI CTGCAG 1 cut(s) 20
BspT107I GGYRCC 1 cut(s) 144
BssECI CCNNGG 1 cut(s) 294
BssMI GATC 2 cut(s) 76, 264
BssNI GRCGYC 1 cut(s) 145
BssSI CACGAG 1 cut(s) 92
BssT1I CCWWGG 1 cut(s) 294
Bst2BI CACGAG 1 cut(s) 92
Bst4CI ACNGT 1 cut(s) 307
BstACI GRCGYC 1 cut(s) 145
BstBAI YACGTR 1 cut(s) 175
BstDEI CTNAG 2 cut(s) 227, 238
BstF5I GGATG 2 cut(s) 214, 290
BstH2I RGCGCY 1 cut(s) 148
BstHHI GCGC 2 cut(s) 69, 147
BstKTI GATC 2 cut(s) 79, 267
BstMBI GATC 2 cut(s) 76, 264
BstMCI CGRYCG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 16
BstV1I GCAGC 2 cut(s) 2, 30
BsuRI GGCC 1 cut(s) 135
BtsCI GGATG 2 cut(s) 214, 290
CfoI GCGC 2 cut(s) 69, 147
Cfr13I GGNCC 1 cut(s) 196
Csp6I GTAC 1 cut(s) 157
CviAII CATG 1 cut(s) 139
CviJI RGCY 6 cut(s) 15, 21, 106, 135, 219, 315
CviKI_1 RGCY 6 cut(s) 15, 21, 106, 135, 219, 315
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 2 cut(s) 227, 238
DinI GGCGCC 1 cut(s) 146
DpnI GATC 2 cut(s) 78, 266
DpnII GATC 2 cut(s) 76, 264
EaeI YGGCCR 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 294
Eco47I GGWCC 1 cut(s) 196
EcoO109I RGGNCCY 1 cut(s) 196
EcoT14I CCWWGG 1 cut(s) 294
EgeI GGCGCC 1 cut(s) 146
EheI GGCGCC 1 cut(s) 146
ErhI CCWWGG 1 cut(s) 294
FaeI CATG 1 cut(s) 142
FaiI YATR 1 cut(s) 140
FaqI GGGAC 1 cut(s) 30
FatI CATG 1 cut(s) 138
FbaI TGATCA 1 cut(s) 264
Fnu4HI GCNGC 3 cut(s) 16, 19, 251
FokI GGATG 2 cut(s) 221, 277
Fsp4HI GCNGC 3 cut(s) 16, 19, 251
GlaI GCGC 2 cut(s) 68, 146
GluI GCNGC 3 cut(s) 16, 19, 251
HaeII RGCGCY 1 cut(s) 148
HaeIII GGCC 1 cut(s) 135
HhaI GCGC 2 cut(s) 69, 147
Hin1I GRCGYC 1 cut(s) 145
Hin1II CATG 1 cut(s) 142
Hin6I GCGC 2 cut(s) 67, 145
HinP1I GCGC 2 cut(s) 67, 145
Hpy188I TCNGA 3 cut(s) 103, 230, 241
Hpy188III TCNNGA 2 cut(s) 74, 191
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 307
HpyCH4IV ACGT 2 cut(s) 43, 174
HpyCH4V TGCA 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 227, 238
HpySE526I ACGT 2 cut(s) 43, 174
Hsp92I GRCGYC 1 cut(s) 145
Hsp92II CATG 1 cut(s) 142
HspAI GCGC 2 cut(s) 67, 145
KasI GGCGCC 1 cut(s) 144
Ksp22I TGATCA 1 cut(s) 264
Kzo9I GATC 2 cut(s) 76, 264
LpnPI CCDG 1 cut(s) 176
Lsp1109I GCAGC 2 cut(s) 2, 30
MaeII ACGT 2 cut(s) 43, 174
MaeIII GTNAC 1 cut(s) 170
MalI GATC 2 cut(s) 78, 266
MboI GATC 2 cut(s) 76, 264
MhlI GDGCHC 1 cut(s) 180
MlsI TGGCCA 1 cut(s) 135
MluCI AATT 2 cut(s) 181, 231
MluNI TGGCCA 1 cut(s) 135
Mly113I GGCGCC 1 cut(s) 145
MmeI TCCRAC 2 cut(s) 101, 311
MnlI CCTC 3 cut(s) 58, 187, 236
Mox20I TGGCCA 1 cut(s) 135
MscI TGGCCA 1 cut(s) 135
MseI TTAA 1 cut(s) 32
Msp20I TGGCCA 1 cut(s) 135
Mva1269I GAATGC 1 cut(s) 253
NarI GGCGCC 1 cut(s) 145
NdeII GATC 2 cut(s) 76, 264
NlaIII CATG 1 cut(s) 142
NlaIV GGNNCC 2 cut(s) 146, 198
NmeAIII GCCGAG 1 cut(s) 47
PcsI WCGNNNNNNNCGW 1 cut(s) 99
PctI GAATGC 1 cut(s) 253
PkrI GCNGC 3 cut(s) 17, 20, 252
Ple19I CGATCG 1 cut(s) 79
PluTI GGCGCC 1 cut(s) 148
Ppu21I YACGTR 1 cut(s) 175
PpuMI RGGWCCY 1 cut(s) 196
Psp5II RGGWCCY 1 cut(s) 196
PspN4I GGNNCC 2 cut(s) 146, 198
PspPI GGNCC 1 cut(s) 196
PspPPI RGGWCCY 1 cut(s) 196
PstI CTGCAG 1 cut(s) 20
PvuI CGATCG 1 cut(s) 79
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
SaqAI TTAA 1 cut(s) 32
SatI GCNGC 3 cut(s) 16, 19, 251
Sau3AI GATC 2 cut(s) 76, 264
Sau96I GGNCC 1 cut(s) 196
SduI GDGCHC 1 cut(s) 180
SetI ASST 6 cut(s) 46, 108, 177, 221, 248, 317
SfcI CTRYAG 1 cut(s) 16
SfoI GGCGCC 1 cut(s) 146
SinI GGWCC 1 cut(s) 196
Sse9I AATT 2 cut(s) 181, 231
SsiI CCGC 1 cut(s) 251
SspDI GGCGCC 1 cut(s) 144
StyI CCWWGG 1 cut(s) 294
TaaI ACNGT 1 cut(s) 307
TaiI ACGT 2 cut(s) 46, 177
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 181, 231
TatI WGTACW 1 cut(s) 156
TauI GCSGC 1 cut(s) 253
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TseI GCWGC 2 cut(s) 15, 18
VpaK11BI GGWCC 1 cut(s) 196
XapI RAATTY 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.