Rh6AG098400

udp-glucuronic acid decarboxylase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
14568800 .. 14573546
4747 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG098400.1

Sequence Viewer

Length: 297 bp
ATGGCTATGGTTAAGAATGAAAAAGACTGCTCCGACGCCATCGACCACTTCAAATTCATATTCAGTAATGCTTTTGAAGAACTACGATTATTGCTACAATTGGAATTGGATAAGCTTGAGCAAAGGGAGTGCCTAAATGGTAGGGGAACTTACTACAGACTTATGAATGAATTGTTCAGTGAGCAATTTGGACCAGAGACAGGAAATGCAGTTCGAGGGTATGGACTTGGAGTAGAGTGGGTTGATGTTCCTGGAATACAAACTGCAAAGCTAGCAGTTTCTCGCGATGTATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

98

Amino Acids

11.24

Weight (kDa)

4.8

Isoelectric Point (pI)

17.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 285
AcsI RAATTY 1 cut(s) 53
AcyI GRCGYC 1 cut(s) 36
AfiI CCNNNNNNNGG 1 cut(s) 200
AgsI TTSAA 2 cut(s) 52, 77
AjnI CCWGG 1 cut(s) 250
AloI GAACNNNNNNTCC 2 cut(s) 195, 227
AluBI AGCT 2 cut(s) 115, 271
AluI AGCT 2 cut(s) 115, 271
Alw26I GTCTC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 191
AsuNHI GCTAGC 1 cut(s) 271
AvaII GGWCC 1 cut(s) 191
BccI CCATC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 191
BfaI CTAG 1 cut(s) 272
BfmI CTRYAG 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 252
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmrFI CCNGG 1 cut(s) 252
BmtI GCTAGC 1 cut(s) 275
BpuEI CTTGAG 1 cut(s) 137
BsaHI GRCGYC 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 252
BseLI CCNNNNNNNGG 1 cut(s) 200
Bsh1236I CGCG 1 cut(s) 285
BslI CCNNNNNNNGG 1 cut(s) 200
BsmAI GTCTC 1 cut(s) 191
Bsp68I TCGCGA 1 cut(s) 285
BspFNI CGCG 1 cut(s) 285
BspOI GCTAGC 1 cut(s) 275
BssNI GRCGYC 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 252
BstACI GRCGYC 1 cut(s) 36
BstC8I GCNNGC 1 cut(s) 273
BstFNI CGCG 1 cut(s) 285
BstMAI GTCTC 1 cut(s) 191
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstNI CCWGG 1 cut(s) 252
BstSCI CCNGG 1 cut(s) 250
BstSFI CTRYAG 1 cut(s) 154
BstUI CGCG 1 cut(s) 285
BtsIMutI CAGTG 1 cut(s) 184
BtuMI TCGCGA 1 cut(s) 285
Cac8I GCNNGC 1 cut(s) 273
Cfr13I GGNCC 1 cut(s) 191
CseI GACGC 1 cut(s) 44
CviJI RGCY 3 cut(s) 5, 115, 271
CviKI_1 RGCY 3 cut(s) 5, 115, 271
Eco47I GGWCC 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 250
FaiI YATR 5 cut(s) 8, 59, 164, 222, 292
FspBI CTAG 1 cut(s) 272
HgaI GACGC 1 cut(s) 44
Hin1I GRCGYC 1 cut(s) 36
HindIII AAGCTT 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 284
Hpy99I CGWCG 1 cut(s) 38
HpyCH4V TGCA 2 cut(s) 209, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
Hsp92I GRCGYC 1 cut(s) 36
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 4 cut(s) 186, 207, 237, 264
MaeI CTAG 1 cut(s) 272
MboII GAAGA 1 cut(s) 89
MfeI CAATTG 1 cut(s) 98
MluCI AATT 5 cut(s) 53, 98, 104, 170, 185
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 1 cut(s) 209
MseI TTAA 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 252
MunI CAATTG 1 cut(s) 98
MvaI CCWGG 1 cut(s) 252
MvnI CGCG 1 cut(s) 285
MwoI GCNNNNNNNGC 1 cut(s) 272
NheI GCTAGC 1 cut(s) 271
NruI TCGCGA 1 cut(s) 285
PfoI TCCNGGA 1 cut(s) 250
Psp6I CCWGG 1 cut(s) 250
PspGI CCWGG 1 cut(s) 250
PspPI GGNCC 1 cut(s) 191
RruI TCGCGA 1 cut(s) 285
SaqAI TTAA 1 cut(s) 12
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 252
SetI ASST 2 cut(s) 117, 273
SfcI CTRYAG 1 cut(s) 154
SgeI CNNG 8 cut(s) 128, 206, 213, 227, 239, 263, 264, 284
SinI GGWCC 1 cut(s) 191
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 5 cut(s) 53, 98, 104, 170, 185
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 250
TaqI TCGA 2 cut(s) 42, 214
TasI AATT 5 cut(s) 53, 98, 104, 170, 185
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 1 cut(s) 184
TspDTI ATGAA 4 cut(s) 33, 46, 179, 183
TspRI CASTG 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 191
XapI RAATTY 1 cut(s) 53
XspI CTAG 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.