Rh6DG081200

udp-glucuronic acid decarboxylase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
9403579 .. 9405280
1702 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG081200.1

Sequence Viewer

Length: 231 bp
ATGGATTCGCAGGAATTTGCAAACCAAGGGAAGTTGGAATTGGATAAGCTTGAGCAAAGGGAGTGCCTAAATGGTAGGGGAACTTACTACAGACTTATGAATGAATTGTTCAGTGAGCAATTTGGACCAGAGACAGGAAATGCAGTTCGAGGGTATGGACTTGGAGTAGAGTGGGTTGATGTTCCTGGAATACAAACTGCAAAGCTAGCAGTTTCTCGCGATGTATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

76

Amino Acids

8.59

Weight (kDa)

4.64

Isoelectric Point (pI)

15.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 219
AcsI RAATTY 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 134
AjnI CCWGG 1 cut(s) 184
AjuI GAANNNNNNNTTGG 2 cut(s) 23, 55
AloI GAACNNNNNNTCC 2 cut(s) 129, 161
AluBI AGCT 2 cut(s) 49, 205
AluI AGCT 2 cut(s) 49, 205
Alw26I GTCTC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 125
AsuNHI GCTAGC 1 cut(s) 205
AvaII GGWCC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 186
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 206
BfmI CTRYAG 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 186
BmtI GCTAGC 1 cut(s) 209
BpuEI CTTGAG 1 cut(s) 71
BsaJI CCNNGG 1 cut(s) 25
Bsc4I CCNNNNNNNGG 1 cut(s) 134
BseBI CCWGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 134
Bsh1236I CGCG 1 cut(s) 219
BslI CCNNNNNNNGG 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 125
Bsp68I TCGCGA 1 cut(s) 219
BspFNI CGCG 1 cut(s) 219
BspOI GCTAGC 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 25
BssT1I CCWWGG 1 cut(s) 25
Bst2UI CCWGG 1 cut(s) 186
BstC8I GCNNGC 1 cut(s) 207
BstFNI CGCG 1 cut(s) 219
BstMAI GTCTC 1 cut(s) 125
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BstSFI CTRYAG 1 cut(s) 88
BstUI CGCG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 118
BtuMI TCGCGA 1 cut(s) 219
Cac8I GCNNGC 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 125
CviJI RGCY 2 cut(s) 49, 205
CviKI_1 RGCY 2 cut(s) 49, 205
Eco130I CCWWGG 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 184
EcoT14I CCWWGG 1 cut(s) 25
ErhI CCWWGG 1 cut(s) 25
FaiI YATR 3 cut(s) 98, 156, 226
FspBI CTAG 1 cut(s) 206
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 218
HpyCH4V TGCA 3 cut(s) 20, 143, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
LpnPI CCDG 4 cut(s) 120, 141, 171, 198
MaeI CTAG 1 cut(s) 206
MluCI AATT 4 cut(s) 14, 38, 104, 119
MmeI TCCRAC 1 cut(s) 15
MnlI CCTC 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
MvnI CGCG 1 cut(s) 219
MwoI GCNNNNNNNGC 1 cut(s) 206
NheI GCTAGC 1 cut(s) 205
NruI TCGCGA 1 cut(s) 219
PfeI GAWTC 1 cut(s) 5
PfoI TCCNGGA 1 cut(s) 184
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspPI GGNCC 1 cut(s) 125
RruI TCGCGA 1 cut(s) 219
Sau96I GGNCC 1 cut(s) 125
ScrFI CCNGG 1 cut(s) 186
SetI ASST 2 cut(s) 51, 207
SfcI CTRYAG 1 cut(s) 88
SinI GGWCC 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
Sse9I AATT 4 cut(s) 14, 38, 104, 119
SspMI CTAG 1 cut(s) 206
StyD4I CCNGG 1 cut(s) 184
StyI CCWWGG 1 cut(s) 25
TaqI TCGA 1 cut(s) 148
TasI AATT 4 cut(s) 14, 38, 104, 119
TfiI GAWTC 1 cut(s) 5
TscAI CASTG 1 cut(s) 118
TspDTI ATGAA 2 cut(s) 113, 117
TspRI CASTG 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 125
XapI RAATTY 1 cut(s) 14
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.