Rh7DG450000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
63867603 .. 63874385
6783 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG450000.1

Sequence Viewer

Length: 195 bp
ATGGCTATGGTTAAGAATGAAAGAGACTGCTCCAGCACCATCGACCACTTCAGGTTGCTGAAGATCCTGTTTTTGCTAGAGATGGTGCAGATGTTTATGTGGACTCTAATATCAGCTTTACTCAAGAGCGAACTATATGTGTTCTACTGGATGCGTCAAGGGCAATATCCTTATTGTATTGTCCCGTGTAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.76

Weight (kDa)

7.71

Isoelectric Point (pI)

22.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 58
AcuI CTGAAG 2 cut(s) 34, 80
AluBI AGCT 1 cut(s) 116
AluI AGCT 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 18
AlwI GGATC 1 cut(s) 58
BccI CCATC 2 cut(s) 47, 76
BcoDI GTCTC 1 cut(s) 18
BfaI CTAG 1 cut(s) 77
BmsI GCATC 1 cut(s) 141
BpmI CTGGAG 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 152
BseGI GGATG 1 cut(s) 156
BseNI ACTGG 1 cut(s) 152
BsgI GTGCAG 1 cut(s) 107
BslFI GGGAC 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 167
Bsp143I GATC 1 cut(s) 63
BspPI GGATC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 152
BssMI GATC 1 cut(s) 63
BstF5I GGATG 1 cut(s) 156
BstKTI GATC 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 18
BstMBI GATC 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 160
BstX2I RGATCY 1 cut(s) 63
BstYI RGATCY 1 cut(s) 63
BtsCI GGATG 1 cut(s) 156
CseI GACGC 1 cut(s) 143
CviJI RGCY 2 cut(s) 5, 116
CviKI_1 RGCY 2 cut(s) 5, 116
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eco57I CTGAAG 2 cut(s) 34, 80
FaiI YATR 4 cut(s) 8, 98, 136, 138
FaqI GGGAC 1 cut(s) 167
FokI GGATG 1 cut(s) 163
FspBI CTAG 1 cut(s) 77
GsuI CTGGAG 1 cut(s) 16
HgaI GACGC 1 cut(s) 143
HinfI GANTC 1 cut(s) 103
Hpy166II GTNNAC 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 88
HpyF10VI GCNNNNNNNGC 1 cut(s) 160
Kzo9I GATC 1 cut(s) 63
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 4 cut(s) 37, 46, 80, 133
LweI GCATC 1 cut(s) 141
MaeI CTAG 1 cut(s) 77
MaeIII GTNAC 1 cut(s) 188
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 1 cut(s) 73
MflI RGATCY 1 cut(s) 63
MlyI GAGTC 1 cut(s) 97
MseI TTAA 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 160
NdeII GATC 1 cut(s) 63
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
PsuI RGATCY 1 cut(s) 63
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 63
SchI GAGTC 1 cut(s) 97
SetI ASST 2 cut(s) 56, 118
SfaNI GCATC 1 cut(s) 141
SgeI CNNG 7 cut(s) 45, 64, 79, 89, 136, 160, 170
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
SspMI CTAG 1 cut(s) 77
TaqI TCGA 1 cut(s) 42
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 33
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.