Rh6BG135200

Histone-lysine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
21281109 .. 21282159
1051 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG135200.1

Sequence Viewer

Length: 306 bp
ATGAGAAAAGCCTCATTGAAATATCCCTCCCCGACGGATATTATGTTGGCCATGACAAGGAAGAAGAGTCCATCTTTAGTCTGCAACAGAAAATGTCAGGGTGATGCTGATGGGTATGATTTAGTTGTTGTTGATGCCATGCATAAAGCAACCTATGCAAGTAGAATTTGTCACTCGTGCCGACCTAATTGTGAAGCAAAAGTTACTGCTGTAGATGATCGTTACCAGATTGGAATCTACACTGTACGTAAGATTAAATACAGTGAAGAGATCACATTGGACTACAACTCTATTAAGGAGGTCTGA

Protein Analysis

101

Amino Acids

11.47

Weight (kDa)

8.99

Isoelectric Point (pI)

38.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SET PF00856 42 - 96 5.3e-12 SET domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 48
AcsI RAATTY 1 cut(s) 165
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 1 cut(s) 57
AgsI TTSAA 1 cut(s) 19
AoxI GGCC 1 cut(s) 48
ApoI RAATTY 1 cut(s) 165
AsuHPI GGTGA 1 cut(s) 113
BalI TGGCCA 1 cut(s) 50
BauI CACGAG 1 cut(s) 175
BccI CCATC 2 cut(s) 79, 104
BfmI CTRYAG 1 cut(s) 210
BmsI GCATC 2 cut(s) 94, 124
BsaAI YACGTR 1 cut(s) 248
BsaBI GATNNNNATC 1 cut(s) 233
Bsc4I CCNNNNNNNGG 1 cut(s) 57
Bse8I GATNNNNATC 1 cut(s) 233
BseJI GATNNNNATC 1 cut(s) 233
BseLI CCNNNNNNNGG 1 cut(s) 57
BshFI GGCC 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 57
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 2 cut(s) 217, 270
BspANI GGCC 1 cut(s) 50
BssMI GATC 2 cut(s) 217, 270
BssSI CACGAG 1 cut(s) 175
Bst2BI CACGAG 1 cut(s) 175
Bst4CI ACNGT 2 cut(s) 244, 263
Bst6I CTCTTC 2 cut(s) 59, 261
BstAPI GCANNNNNTGC 1 cut(s) 155
BstBAI YACGTR 1 cut(s) 248
BstKTI GATC 2 cut(s) 220, 273
BstMBI GATC 2 cut(s) 217, 270
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 210
BstSNI TACGTA 1 cut(s) 248
BsuRI GGCC 1 cut(s) 50
BtsIMutI CAGTG 2 cut(s) 240, 268
Csp6I GTAC 1 cut(s) 245
CviAII CATG 2 cut(s) 52, 139
CviJI RGCY 2 cut(s) 11, 50
CviKI_1 RGCY 2 cut(s) 11, 50
CviQI GTAC 1 cut(s) 245
DpnI GATC 2 cut(s) 219, 272
DpnII GATC 2 cut(s) 217, 270
EaeI YGGCCR 1 cut(s) 48
Eam1104I CTCTTC 2 cut(s) 59, 261
EarI CTCTTC 2 cut(s) 59, 261
Eco105I TACGTA 1 cut(s) 248
EcoT22I ATGCAT 1 cut(s) 144
FaeI CATG 2 cut(s) 55, 142
FaiI YATR 6 cut(s) 44, 53, 117, 140, 144, 156
FatI CATG 2 cut(s) 51, 138
HaeIII GGCC 1 cut(s) 50
Hin1II CATG 2 cut(s) 55, 142
HinfI GANTC 2 cut(s) 67, 234
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 305
Hpy99I CGWCG 1 cut(s) 37
HpyCH4III ACNGT 2 cut(s) 244, 263
HpyCH4IV ACGT 1 cut(s) 247
HpyCH4V TGCA 3 cut(s) 84, 142, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 247
Hsp92II CATG 2 cut(s) 55, 142
Kzo9I GATC 2 cut(s) 217, 270
LpnPI CCDG 2 cut(s) 83, 239
LweI GCATC 2 cut(s) 94, 124
MaeII ACGT 1 cut(s) 247
MaeIII GTNAC 3 cut(s) 170, 202, 221
MalI GATC 2 cut(s) 219, 272
MboI GATC 2 cut(s) 217, 270
MboII GAAGA 3 cut(s) 73, 76, 278
MlsI TGGCCA 1 cut(s) 50
MluCI AATT 2 cut(s) 165, 187
MluNI TGGCCA 1 cut(s) 50
MlyI GAGTC 1 cut(s) 76
MnlI CCTC 3 cut(s) 22, 37, 292
Mox20I TGGCCA 1 cut(s) 50
Mph1103I ATGCAT 1 cut(s) 144
MscI TGGCCA 1 cut(s) 50
MseI TTAA 2 cut(s) 255, 294
Msp20I TGGCCA 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 2 cut(s) 217, 270
NlaIII CATG 2 cut(s) 55, 142
NmuCI GTSAC 1 cut(s) 170
NsiI ATGCAT 1 cut(s) 144
PfeI GAWTC 1 cut(s) 234
PleI GAGTC 1 cut(s) 75
PpsI GAGTC 1 cut(s) 75
Ppu21I YACGTR 1 cut(s) 248
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SaqAI TTAA 2 cut(s) 255, 294
Sau3AI GATC 2 cut(s) 217, 270
SchI GAGTC 1 cut(s) 76
SetI ASST 4 cut(s) 155, 187, 250, 303
SfaNI GCATC 2 cut(s) 94, 124
SfcI CTRYAG 1 cut(s) 210
SgeI CNNG 9 cut(s) 43, 64, 69, 110, 151, 171, 187, 189, 238
SnaBI TACGTA 1 cut(s) 248
Sse9I AATT 2 cut(s) 165, 187
TaaI ACNGT 2 cut(s) 244, 263
TaiI ACGT 1 cut(s) 250
TasI AATT 2 cut(s) 165, 187
TfiI GAWTC 1 cut(s) 234
Tru1I TTAA 2 cut(s) 255, 294
Tru9I TTAA 2 cut(s) 255, 294
TscAI CASTG 2 cut(s) 247, 268
TseFI GTSAC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 170
TspGWI ACGGA 1 cut(s) 50
TspRI CASTG 2 cut(s) 247, 268
XapI RAATTY 1 cut(s) 165
Zsp2I ATGCAT 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.