Rh6BG393700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
62237587 .. 62237799
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG393700.1

Sequence Viewer

Length: 213 bp
ATGAGCGACACAAGGTTCTTGGAGAATGGTAAGTACTACTATGACCCCAACAGAGAGAACAACTACAATAAGAACCAGTACAAGAACTCGTTTGCAACCTGCACCAAATTCTCCACCCTCATTCGCAACTTCTGCTGGACGACCAAGGGTCGCAACGTCTTCCTCTCTGATCTCGTCTCCACCGCCTCCTCCGATCCCCCCGACGGCTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.22

Weight (kDa)

8.64

Isoelectric Point (pI)

31.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 107
AciI CCGC 1 cut(s) 183
AclWI GGATC 1 cut(s) 188
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 2 cut(s) 35, 80
AfiI CCNNNNNNNGG 2 cut(s) 203, 207
AhdI GACNNNNNGTC 1 cut(s) 147
Alw26I GTCTC 1 cut(s) 181
AlwI GGATC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 107
BbsI GAAGAC 1 cut(s) 151
BcoDI GTCTC 1 cut(s) 181
BfuAI ACCTGC 1 cut(s) 107
BmcAI AGTACT 1 cut(s) 35
BmeRI GACNNNNNGTC 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 151
BsaJI CCNNGG 1 cut(s) 144
Bsc4I CCNNNNNNNGG 2 cut(s) 203, 207
Bse1I ACTGG 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 144
BseLI CCNNNNNNNGG 2 cut(s) 203, 207
BseNI ACTGG 1 cut(s) 76
BseRI GAGGAG 1 cut(s) 178
BsgI GTGCAG 1 cut(s) 85
BslI CCNNNNNNNGG 2 cut(s) 203, 207
BsmAI GTCTC 1 cut(s) 181
BsmBI CGTCTC 1 cut(s) 181
Bsp143I GATC 2 cut(s) 169, 193
BspACI CCGC 1 cut(s) 183
BspMI ACCTGC 1 cut(s) 107
BspPI GGATC 1 cut(s) 188
BsrI ACTGG 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 2 cut(s) 169, 193
BssT1I CCWWGG 1 cut(s) 144
BstAPI GCANNNNNTGC 1 cut(s) 132
BstKTI GATC 2 cut(s) 172, 196
BstMAI GTCTC 1 cut(s) 181
BstMBI GATC 2 cut(s) 169, 193
BstMWI GCNNNNNNNGC 1 cut(s) 132
BstV2I GAAGAC 1 cut(s) 151
BveI ACCTGC 1 cut(s) 107
Csp6I GTAC 2 cut(s) 34, 79
CviJI RGCY 1 cut(s) 207
CviKI_1 RGCY 1 cut(s) 207
CviQI GTAC 2 cut(s) 34, 79
DpnI GATC 2 cut(s) 171, 195
DpnII GATC 2 cut(s) 169, 193
DriI GACNNNNNGTC 1 cut(s) 147
Eam1105I GACNNNNNGTC 1 cut(s) 147
Eco130I CCWWGG 1 cut(s) 144
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
Esp3I CGTCTC 1 cut(s) 181
FaiI YATR 1 cut(s) 42
Hpy188I TCNGA 2 cut(s) 169, 193
Hpy99I CGWCG 1 cut(s) 206
HpyCH4IV ACGT 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 95, 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 132
HpySE526I ACGT 1 cut(s) 156
Kzo9I GATC 2 cut(s) 169, 193
LpnPI CCDG 4 cut(s) 89, 112, 121, 193
MaeII ACGT 1 cut(s) 156
MalI GATC 2 cut(s) 171, 195
MboI GATC 2 cut(s) 169, 193
MboII GAAGA 1 cut(s) 151
MluCI AATT 1 cut(s) 107
MnlI CCTC 4 cut(s) 128, 173, 196, 199
MwoI GCNNNNNNNGC 1 cut(s) 132
NdeII GATC 2 cut(s) 169, 193
RsaI GTAC 2 cut(s) 35, 80
RsaNI GTAC 2 cut(s) 34, 79
Sau3AI GATC 2 cut(s) 169, 193
ScaI AGTACT 1 cut(s) 35
SetI ASST 3 cut(s) 17, 101, 159
SgeI CNNG 9 cut(s) 24, 31, 88, 94, 100, 111, 148, 157, 185
Sse9I AATT 1 cut(s) 107
SsiI CCGC 1 cut(s) 183
StyI CCWWGG 1 cut(s) 144
TaiI ACGT 1 cut(s) 159
TasI AATT 1 cut(s) 107
TatI WGTACW 2 cut(s) 33, 78
XapI RAATTY 1 cut(s) 107
ZrmI AGTACT 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.