Rh7AG154200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
12510618 .. 12510830
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG154200.1

Sequence Viewer

Length: 213 bp
ATGAGCGACACAAGGTTCTTGGAGAATGGTAAGCACTACTACGACCCCAACAACGAGAACAACTACAATCAGAAACAGTACAAGAACTCGTTTGCAACCTGCACCAAATTCTCCACCCTCATTCACAACGTCTGCTGGACGACCAAGGGTCGCAACGTCTTCCTCTCTGATCTTGTCTCCGCCGCCTCCTCCAATCCCCCCGACGGCTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.07

Weight (kDa)

7.79

Isoelectric Point (pI)

40.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 107
AciI CCGC 2 cut(s) 180, 183
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 80
AfiI CCNNNNNNNGG 2 cut(s) 203, 207
AhdI GACNNNNNGTC 1 cut(s) 147
Alw26I GTCTC 1 cut(s) 181
ApoI RAATTY 1 cut(s) 107
BbsI GAAGAC 1 cut(s) 151
BcoDI GTCTC 1 cut(s) 181
BfuAI ACCTGC 1 cut(s) 107
BisI GCNGC 1 cut(s) 183
BlsI GCNGC 1 cut(s) 184
BmeRI GACNNNNNGTC 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 151
BsaJI CCNNGG 1 cut(s) 144
Bsc4I CCNNNNNNNGG 2 cut(s) 203, 207
BseDI CCNNGG 1 cut(s) 144
BseLI CCNNNNNNNGG 2 cut(s) 203, 207
BseRI GAGGAG 1 cut(s) 178
BsgI GTGCAG 1 cut(s) 85
BslI CCNNNNNNNGG 2 cut(s) 203, 207
BsmAI GTCTC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 169
BspACI CCGC 2 cut(s) 180, 183
BspMI ACCTGC 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 1 cut(s) 169
BssT1I CCWWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 78
BstKTI GATC 1 cut(s) 172
BstMAI GTCTC 1 cut(s) 181
BstMBI GATC 1 cut(s) 169
BstV2I GAAGAC 1 cut(s) 151
BveI ACCTGC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 79
CviJI RGCY 1 cut(s) 207
CviKI_1 RGCY 1 cut(s) 207
CviQI GTAC 1 cut(s) 79
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
DriI GACNNNNNGTC 1 cut(s) 147
Eam1105I GACNNNNNGTC 1 cut(s) 147
EciI GGCGGA 1 cut(s) 169
Eco130I CCWWGG 1 cut(s) 144
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
Fnu4HI GCNGC 1 cut(s) 183
Fsp4HI GCNGC 1 cut(s) 183
GluI GCNGC 1 cut(s) 183
Hpy188I TCNGA 2 cut(s) 72, 169
Hpy99I CGWCG 1 cut(s) 206
HpyCH4III ACNGT 1 cut(s) 78
HpyCH4IV ACGT 2 cut(s) 129, 156
HpyCH4V TGCA 2 cut(s) 95, 102
HpySE526I ACGT 2 cut(s) 129, 156
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 3 cut(s) 112, 121, 193
MaeII ACGT 2 cut(s) 129, 156
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MboII GAAGA 1 cut(s) 151
MluCI AATT 1 cut(s) 107
MnlI CCTC 4 cut(s) 128, 173, 196, 199
NdeII GATC 1 cut(s) 169
PkrI GCNGC 1 cut(s) 184
RsaI GTAC 1 cut(s) 80
RsaNI GTAC 1 cut(s) 79
SatI GCNGC 1 cut(s) 183
Sau3AI GATC 1 cut(s) 169
SetI ASST 4 cut(s) 17, 101, 132, 159
SgeI CNNG 9 cut(s) 24, 31, 67, 94, 100, 111, 148, 157, 185
Sse9I AATT 1 cut(s) 107
SsiI CCGC 2 cut(s) 180, 183
StyI CCWWGG 1 cut(s) 144
TaaI ACNGT 1 cut(s) 78
TaiI ACGT 2 cut(s) 132, 159
TasI AATT 1 cut(s) 107
TatI WGTACW 1 cut(s) 78
TauI GCSGC 1 cut(s) 185
XapI RAATTY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.